Loading ...
Sorry, an error occurred while loading the content.

RE: [PBML] Mac OS X terminal question

Expand Messages
  • Fortuno, Adam
    Augustine, Alright Mac brother, lets roll up our sleeves and do a little MacOS X commandline/Perl 101. All Mac s ship with Perl. If you re running Panther, you
    Message 1 of 19 , Feb 4, 2004

      Alright Mac brother, lets roll up our sleeves and do a little MacOS X
      commandline/Perl 101.

      All Mac's ship with Perl. If you're running Panther, you have Perl 5.8.1 (by
      default). If you're running Jaguar, you have Perl 5.6.0 (by default). Like
      John said, don't worry about where Perl is on your workstation. The
      operating system is smart enough to know where Perl is (investigate the Path
      if your interested in how it does this). If you ever doubt that Perl is on
      your Mac, type `Perl -v` at the commandline. You will see version
      information for your build of Perl.

      As for your code, here is my feedback (my comments are prefixed with **).

      === CODE: Original w/comments ===

      #!/usr/bin/perl -w


      ** The print function is `print` not `PRINT`, case matters.
      PRINT DNA;


      Ultimately, I know you're doing an excersie, but it would give me a warm
      fuzzy if you just wrote:

      === CODE: Suggested ===

      #! /usr/bin/perl

      I assume you're working at the commandline and not through Aqua. Keep in
      mind, your running this in Unix. After you creat the file with the code in
      it. You need to change the files permissions to allow you to RUN the script.
      To do this, get a handy Unix how-to book, or blindly follow my advice: chmod
      u+x <file_name> (e.g. chmod u+x test.pl). If you don't do this, when you
      attempt to run the script you will get a permission error.

      Texteditors! You're going to start an old fashion brawl with this question.
      On X, you've choices that include:
      - X Code (Panther only)
      - Project Builder (Jaguar and 10.1.x)
      - BBEdit
      - VIM
      - EMACS

      I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
      Project Builder. Project Builder is provided free of charge by Apple. Its a
      robust text editor for use in Aqua. VIM executes from the shell. Its tough
      to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
      you'll find it all over, and its very helpful. For you, I recommend Project
      Builder, but once you've got a better handle on Perl take the time to work
      in VIM.


      F.Y.I: Mac specific Perl help try the OS X Perl list->
      http://lists.cpan.org/showlist.cgi?name=macosx (Don't let Randall know I'm
      pushing the web again)

      -----Original Message-----
      From: wadunn83 [mailto:wadunn83@...]
      Sent: Tuesday, February 03, 2004 5:15 PM
      To: perl-beginner@yahoogroups.com
      Subject: [PBML] Mac OS X terminal question

      First: thanks again for all the help in picking a book.

      Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
      type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
      am completely failing. Can a fellow Mac Perl-er help me out with the
      logistics of where to write the code, where to save it, and how to
      tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
      about to shatter my poor computer screen. I am getting the coding
      ideas I just cant figure out the system. Thank you all for your
      patience. Also, can a Mac person suggest a good free text editor to
      use in writing the code.


      FYI the code is:

      #!/usr/bin/perl -w

      PRINT DNA;

    • painter_man
      ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
      Message 2 of 19 , Feb 4, 2004
        --- In perl-beginner@yahoogroups.com, "Maria K Meyers" <mmeyer4@h...>
        > >Doesn't Mac OSX come with vi? What could be better?
        > >Ooh, I'm gonna take heat for that one.
        > Nothing is better than vi.
        > Vi is the best editor in the world.
        > I am a loyal unix user.
        > I love vi.
        > Ah, vi.
        > Vi.
        > ~Maria

        Vi is an emacs macro to hide the power of a real editor from those
        who are not yet ready for it.
        <grins and returns to temple to wait for another novice>
      • Maria K Meyers
        ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
        Message 3 of 19 , Feb 4, 2004
          > Nothing is better than vi.
          > Vi is the best editor in the world.
          > I am a loyal unix user.
          > I love vi.
          > Ah, vi.
          > Vi.
          > ~Maria

          Vi is an emacs macro to hide the power of a real editor from those
          who are not yet ready for it.
          <grins and returns to temple to wait for another novice>

          Oh great and wise one, how might I be ever deemed to learned such
          All praise the great one.
          I will however contine in my ignorance with the blissful use of vi.
          Ah, vi.

        • Paul Archer
          ... From the VI lovers page (www.thomer.com/vi/vi.html): Don t get me wrong: Emacs is a great operating system--it lacks a good editor, though. Paul That
          Message 4 of 19 , Feb 4, 2004
            > > >Doesn't Mac OSX come with vi? What could be better?
            > >
            > > >Ooh, I'm gonna take heat for that one.
            > >
            > > Nothing is better than vi.
            > > Vi is the best editor in the world.
            > > I am a loyal unix user.
            > > I love vi.
            > > Ah, vi.
            > > Vi.
            > >
            > > ~Maria
            > Vi is an emacs macro to hide the power of a real editor from those
            > who are not yet ready for it.

            From the VI lovers' page (www.thomer.com/vi/vi.html):

            Don't get me wrong: Emacs is a great operating system--it lacks a good
            editor, though.

            Paul "That 'Six' editor is great!" Archer
          • Paul Archer
            ... I would add jEdit to that list. It s Java-based, so you have to have a JVM (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
            Message 5 of 19 , Feb 4, 2004
              9:21am, Fortuno, Adam wrote:

              > Texteditors! You're going to start an old fashion brawl with this question.
              > On X, you've choices that include:
              > - X Code (Panther only)
              > - Project Builder (Jaguar and 10.1.x)
              > - BBEdit
              > - VIM
              > - EMACS
              > I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
              > Project Builder. Project Builder is provided free of charge by Apple. Its a
              > robust text editor for use in Aqua. VIM executes from the shell. Its tough
              > to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
              > you'll find it all over, and its very helpful. For you, I recommend Project
              > Builder, but once you've got a better handle on Perl take the time to work
              > in VIM.

              I would add jEdit to that list. It's Java-based, so you have to have a JVM
              (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
              www.sun.com/java to get a JVM.
              Anyway, jEdit is free, easy to use, and one file installs and runs on Mac,
              Windows, and pretty much any Unix you care to name (Linux, Solaris, *BSD,
              etc). www.jedit.org


              I judge a religion as being good or bad
              based on whether its adherents become
              better people as a result of practicing it.
              - Joe Mullally, computer salesman
            • merlyn@stonehenge.com
              ... Adam Like John said, don t worry about where Perl is on your Adam workstation. Uh, you have to worry, because the #! line has to be correct. Adam The
              Message 6 of 19 , Feb 5, 2004
                >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                Adam> Like John said, don't worry about where Perl is on your
                Adam> workstation.

                Uh, you have to worry, because the #! line has to be correct.

                Adam> The operating system is smart enough to know where Perl is
                Adam> (investigate the Path if your interested in how it does this).

                No, it's not.

                Adam> If you ever doubt that Perl is on
                Adam> your Mac, type `Perl -v` at the commandline.

                No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.

                Remember, when you post a wrong answer, I have to spend time fixing
                the incorrect answer, instead of answering a new question.

                Please consider that if you're less experienced. Doublecheck your
                facts before you post.

                Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
              • Fortuno, Adam
                Can t argue with that. What he said. ... From: merlyn@stonehenge.com [mailto:merlyn@stonehenge.com] Sent: Thursday, February 05, 2004 5:35 AM To:
                Message 7 of 19 , Feb 5, 2004
                  Can't argue with that. What he said.

                  -----Original Message-----
                  From: merlyn@... [mailto:merlyn@...]
                  Sent: Thursday, February 05, 2004 5:35 AM
                  To: perl-beginner@yahoogroups.com
                  Subject: Re: [PBML] Mac OS X terminal question

                  >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                  Adam> Like John said, don't worry about where Perl is on your
                  Adam> workstation.

                  Uh, you have to worry, because the #! line has to be correct.

                  Adam> The operating system is smart enough to know where Perl is
                  Adam> (investigate the Path if your interested in how it does this).

                  No, it's not.

                  Adam> If you ever doubt that Perl is on
                  Adam> your Mac, type `Perl -v` at the commandline.

                  No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.

                  Remember, when you post a wrong answer, I have to spend time fixing
                  the incorrect answer, instead of answering a new question.

                  Please consider that if you're less experienced. Doublecheck your
                  facts before you post.

                  Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                  <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                  Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                  See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl

                  Unsubscribing info is here:
                  Yahoo! Groups Links
                • Fortuno, Adam
                  Peter, I think you can still get jEdit through Apple s site too (see URL at the bottom of the page).
                  Message 8 of 19 , Feb 5, 2004

                    I think you can still get jEdit through Apple's site too (see URL at the
                    bottom of the page).



                    -----Original Message-----
                    From: Peter Dominey [mailto:pdominey@...]
                    Sent: Wednesday, February 04, 2004 10:44 AM
                    To: perl-beginner@yahoogroups.com
                    Subject: Re: [PBML] Mac OS X terminal question

                    --- Jeff Eggen <jeggen@...> wrote:
                    > >>> wadunn83@... 02/03/04 04:15pm >>>
                    > >Now: I bought Tisdall's Beg Perl for
                    > Bioinformatics. I am trying to
                    > >type and run a SIMPLE example in my Mac OS 10.2.x
                    > Unix terminal and I
                    > >am completely failing. Can a fellow Mac Perl-er
                    > help me out with the
                    > >logistics of where to write the code, where to save
                    > it, and how to
                    > >tell my computer to run it. I KNOW THIS IS BELOW
                    > you all, but I am
                    > >about to shatter my poor computer screen. I am
                    > getting the coding
                    > >ideas I just cant figure out the system. Thank you
                    > all for your
                    > >patience. Also, can a Mac person suggest a good
                    > free text editor to
                    > >use in writing the code.
                    > Doesn't Mac OSX come with vi? What could be better?
                    > Ooh, I'm gonna take heat for that one.
                    > Seriously, though, if there is a Notepad-like editor
                    > that lets you save simple text files, you can just
                    > use that to code. Or, a search on google for
                    > editors would probably turn up something.
                    > >-Augustine
                    > >FYI the code is:
                    > >#!/usr/bin/perl -w
                    > >$DNA = 'AACGGTATGACTGAACGCGGTAGC';
                    > >PRINT DNA;
                    > >EXIT;
                    > Is your code actually this case? In caps, I mean.
                    > If so, it won't run. Try this:
                    > #!/usr/bin/perl -w
                    > use strict; # Very necessary for a newbie!!
                    > my $DNA = 'AACGGTATGACTGAACGCGGTAGC';
                    > print $DNA, "\n"; # You need the dollar sign
                    > exit;
                    > I'm unfamiliar with Mac OSX workings, but if you
                    > have some kind of command shell that is anything
                    > like unix, just try to run the script via the
                    > following commands:
                    > First, make it executable:
                    > chmod u+x yourscript.pl
                    > Then, run it:
                    > ./yourscript.pl
                    > If it isn't, then you can ignore that bit.
                    > If you are attempting to run your script and getting
                    > errors, post the errors so we know where to help
                    > you.


                    Wonderfully MAC OS X is really UNIX. So from a
                    terminal you can follow pretty much all the rules and
                    instructions for using and working with PERL on UNIX.

                    The vi editor is available on OS X and I find it as
                    quick and easy to use as anything else. Certainly
                    while in a terminal it's so much quicker than opening
                    up seperate apps.

                    The first rule to follow ism know where perl is
                    instaalled, do the command 'which perl' to tell you
                    where it is located it'll be something like
                    /usr/bin/perl or maybe /usr/local/bin/perl. This is
                    what you need at the top of your script following the

                    Next, for ease of use make sure your currect directory
                    is in you PATH. so enter the command PATH=$PATH:.
                    This will append the 'current' directory to you path
                    and therefore 'find' any executable (script etc)) in
                    your current dir (after searching the previous
                    directories defined in the PATH variable). It's worth
                    noting however that the command above is only valid
                    for the time you have that particula terminal session
                    open. For it to be configured for everytime you open a
                    terminal you'll need to change one or two other file.
                    But that a whole different topic.

                    Hope this is of assitance.


                    P J Dominey
                    Independent UNIX Contractor

                    E-Mail: pdominey@...
                    Web Site: www.dominey.biz
                    Tel: 972-424-5705 Yahoo IM: pdominey

                    Do you Yahoo!?
                    Yahoo! SiteBuilder - Free web site building tool. Try it!

                    Unsubscribing info is here:

                    Yahoo! Groups Links

                    To visit your group on the web, go to:

                    To unsubscribe from this group, send an email to:

                    Your use of Yahoo! Groups is subject to:
                  • Peter Dominey
                    ... http://www.apple.com/downloads/macosx/development_tools/jedit.html ... Adam, I m pretty sure you are right. I m just an old dyed-the-wool UNIX guy so tend
                    Message 9 of 19 , Feb 5, 2004
                      --- "Fortuno, Adam" <fortunoa@...> wrote:
                      > Peter,
                      > I think you can still get jEdit through Apple's site
                      > too (see URL at the
                      > bottom of the page).
                      > Regards,
                      > Adam


                      I'm pretty sure you are right. I'm just an old
                      dyed-the-wool UNIX guy so tend to stick with ed or vi
                      (although these days vim as a replacement of 'real'
                      vi) :)

                      Ofcourse as a UNIX by preference person, I'm just over
                      the moon at Apple moving to it and now of course
                      Novell doing the same thing.


                      P J Dominey
                      Independent UNIX Contractor

                      E-Mail: pdominey@...
                      Web Site: www.dominey.biz
                      Tel: 972-424-5705 Yahoo IM: pdominey

                      Do you Yahoo!?
                      Yahoo! Finance: Get your refund fast by filing online.
                    • Fortuno, Adam
                      Peter, I like VI too. I m just a text editor slut so I go between VI and XCode fairly often. Regarding what you said about OS X, I empathize. The Unix/Mac
                      Message 10 of 19 , Feb 5, 2004

                        I like VI too. I'm just a text editor slut so I go between VI and XCode
                        fairly often.

                        Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                        provided more synergies that I ever guessed. The platform's flexibility has
                        certainly leapt over preceding OS versions. I've had modest UNIX exposure
                        prior to X. However, working with X on a daily basis has given incentives to
                        do more work at the command line - for the most part its been fruitful. I
                        (as Randal pointed out) have a long way to go in-terms of learning, but the
                        impact on what I can do using my Mac has increased.

                        As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                        really-really slow on my G3 laptop so I ditched it.


                        -----Original Message-----
                        From: Peter Dominey [mailto:pdominey@...]
                        Sent: Thursday, February 05, 2004 9:00 AM
                        To: perl-beginner@yahoogroups.com
                        Subject: RE: [PBML] Mac OS X terminal question

                        --- "Fortuno, Adam" <fortunoa@...> wrote:
                        > Peter,
                        > I think you can still get jEdit through Apple's site
                        > too (see URL at the
                        > bottom of the page).
                        > Regards,
                        > Adam


                        I'm pretty sure you are right. I'm just an old
                        dyed-the-wool UNIX guy so tend to stick with ed or vi
                        (although these days vim as a replacement of 'real'
                        vi) :)

                        Ofcourse as a UNIX by preference person, I'm just over
                        the moon at Apple moving to it and now of course
                        Novell doing the same thing.


                        P J Dominey
                        Independent UNIX Contractor

                        E-Mail: pdominey@...
                        Web Site: www.dominey.biz
                        Tel: 972-424-5705 Yahoo IM: pdominey

                        Do you Yahoo!?
                        Yahoo! Finance: Get your refund fast by filing online.

                        Unsubscribing info is here:
                        Yahoo! Groups Links
                      • Rob Dowell
                        The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment)
                        Message 11 of 19 , Feb 5, 2004
                          The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment) whenever I can though.

                          "Fortuno, Adam" <fortunoa@...> wrote:Peter,

                          I like VI too. I'm just a text editor slut so I go between VI and XCode
                          fairly often.

                          Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                          provided more synergies that I ever guessed. The platform's flexibility has
                          certainly leapt over preceding OS versions. I've had modest UNIX exposure
                          prior to X. However, working with X on a daily basis has given incentives to
                          do more work at the command line - for the most part its been fruitful. I
                          (as Randal pointed out) have a long way to go in-terms of learning, but the
                          impact on what I can do using my Mac has increased.

                          As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                          really-really slow on my G3 laptop so I ditched it.


                          -----Original Message-----
                          From: Peter Dominey [mailto:pdominey@...]
                          Sent: Thursday, February 05, 2004 9:00 AM
                          To: perl-beginner@yahoogroups.com
                          Subject: RE: [PBML] Mac OS X terminal question

                          --- "Fortuno, Adam" <fortunoa@...> wrote:
                          > Peter,
                          > I think you can still get jEdit through Apple's site
                          > too (see URL at the
                          > bottom of the page).
                          > Regards,
                          > Adam


                          I'm pretty sure you are right. I'm just an old
                          dyed-the-wool UNIX guy so tend to stick with ed or vi
                          (although these days vim as a replacement of 'real'
                          vi) :)

                          Ofcourse as a UNIX by preference person, I'm just over
                          the moon at Apple moving to it and now of course
                          Novell doing the same thing.


                          P J Dominey
                          Independent UNIX Contractor

                          E-Mail: pdominey@...
                          Web Site: www.dominey.biz
                          Tel: 972-424-5705 Yahoo IM: pdominey

                          Do you Yahoo!?
                          Yahoo! Finance: Get your refund fast by filing online.

                          Unsubscribing info is here:
                          Yahoo! Groups Links

                          Unsubscribing info is here: http://help.yahoo.com/help/us/groups/groups-32.html

                          Yahoo! Groups Links

                          To visit your group on the web, go to:

                          To unsubscribe from this group, send an email to:

                          Your use of Yahoo! Groups is subject to the Yahoo! Terms of Service.

                          Do you Yahoo!?
                          Yahoo! Finance: Get your refund fast by filing online

                          [Non-text portions of this message have been removed]
                        • Hans Ginzel
                          ... Perl won the Linux Journal Editors Choice Award :-) http://www.linuxjournal.com/article.php?sid=6868 VIM is the Favorite Text Editor (Linux Journal
                          Message 12 of 19 , Feb 5, 2004
                            On Wed, Feb 04, 2004 at 11:00:04AM -0600, Maria K Meyers wrote:
                            > >Doesn't Mac OSX come with vi? What could be better?
                            > Vi is the best editor in the world.

                            Perl won the Linux Journal Editors' Choice Award :-)

                            VIM is the Favorite Text Editor
                            (Linux Journal Readers' Choice Awards) :-)


                            PS: Wish for next version of perl:
                            /--v(?-ersion)/ would be a shorthand for
                          • merlyn@stonehenge.com
                            ... Hans VIM is the Favorite Text Editor Hans (Linux Journal Readers Choice Awards) :-) Hans http://www.linuxjournal.com/article.php?sid=7029 ooh, this is
                            Message 13 of 19 , Feb 5, 2004
                              >>>>> "Hans" == Hans Ginzel <hans@...> writes:

                              Hans> VIM is the Favorite Text Editor
                              Hans> (Linux Journal Readers' Choice Awards) :-)
                              Hans> http://www.linuxjournal.com/article.php?sid=7029

                              ooh, this is so obviously biased! I demand a florida-style recount!
                              Over and over. In fact, I can program my Emacs operating system
                              to send email until it gets changed!

                              Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                              <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                              Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                              See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
                            • Jeff 'japhy' Pinyan
                              ... Have you let the Perl Porters know? Sadly, you can t use (?-...), because (?-...) is reserved for turning off regex flags (so (?-i) turns off
                              Message 14 of 19 , Feb 5, 2004
                                On Feb 5, Hans Ginzel said:

                                >PS: Wish for next version of perl:
                                >/--v(?-ersion)/ would be a shorthand for

                                Have you let the Perl Porters know? Sadly, you can't use (?-...), because
                                (?-...) is reserved for turning off regex flags (so (?-i) turns off

                                However, (??ersion) seems appropriate to me, even if it looks a little
                                noisy. I could add support for it in Regexp::Parser when I finish it.

                                Jeff "japhy" Pinyan japhy@... http://www.pobox.com/~japhy/
                                RPI Acacia brother #734 http://www.perlmonks.org/ http://www.cpan.org/
                                <stu> what does y/// stand for? <tenderpuss> why, yansliterate of course.
                                [ I'm looking for programming work. If you like my work, let me know. ]
                              Your message has been successfully submitted and would be delivered to recipients shortly.