Loading ...
Sorry, an error occurred while loading the content.

Re: [PBML] Mac OS X terminal question

Expand Messages
  • Jeff Eggen
    ... Doesn t Mac OSX come with vi? What could be better? Ooh, I m gonna take heat for that one. Seriously, though, if there is a Notepad-like editor that lets
    Message 1 of 19 , Feb 3 3:02 PM
    • 0 Attachment
      >>> wadunn83@... 02/03/04 04:15pm >>>
      >Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
      >type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
      >am completely failing. Can a fellow Mac Perl-er help me out with the
      >logistics of where to write the code, where to save it, and how to
      >tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
      >about to shatter my poor computer screen. I am getting the coding
      >ideas I just cant figure out the system. Thank you all for your
      >patience. Also, can a Mac person suggest a good free text editor to
      >use in writing the code.

      Doesn't Mac OSX come with vi? What could be better?

      Ooh, I'm gonna take heat for that one.

      Seriously, though, if there is a Notepad-like editor that lets you save simple text files, you can just use that to code. Or, a search on google for editors would probably turn up something.

      >-Augustine

      >FYI the code is:

      >#!/usr/bin/perl -w
      >$DNA = 'AACGGTATGACTGAACGCGGTAGC';

      >PRINT DNA;

      >EXIT;

      Is your code actually this case? In caps, I mean. If so, it won't run. Try this:

      #!/usr/bin/perl -w

      use strict; # Very necessary for a newbie!!

      my $DNA = 'AACGGTATGACTGAACGCGGTAGC';

      print $DNA, "\n"; # You need the dollar sign
      exit;

      I'm unfamiliar with Mac OSX workings, but if you have some kind of command shell that is anything like unix, just try to run the script via the following commands:

      First, make it executable:
      chmod u+x yourscript.pl

      Then, run it:
      ./yourscript.pl

      If it isn't, then you can ignore that bit.

      If you are attempting to run your script and getting errors, post the errors so we know where to help you.

      Hope this helps,

      Jeff Eggen
      IT Programmer Analyst
      Saskatchewan Government Insurance
      Ph (306) 751-1795
      email jeggen@...
    • franki
      A mac using friend of mine swears by pagespinner.. http://www.optima-system.com/pagespinner/ but OSX is based on freeBSD so anything that works on that can
      Message 2 of 19 , Feb 3 3:12 PM
      • 0 Attachment
        A mac using friend of mine swears by pagespinner..
        http://www.optima-system.com/pagespinner/

        but OSX is based on freeBSD so anything that works on that can usually
        be made to work on OSX and most have packages already made for you..
        (google is your friend.)

        hmmm, unix type text editors... the list is very long, I spose the most
        well known would be vi and emacs.. but there are about 3 dozen others..

        Unix users are very loyal to their text editors, so when you choose one,
        be careful who you tell about your choice :-)

        regards

        Franki


        Jeff Eggen wrote:

        >>>>wadunn83@... 02/03/04 04:15pm >>>
        >>
        >>Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
        >>type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
        >>am completely failing. Can a fellow Mac Perl-er help me out with the
        >>logistics of where to write the code, where to save it, and how to
        >>tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
        >>about to shatter my poor computer screen. I am getting the coding
        >>ideas I just cant figure out the system. Thank you all for your
        >>patience. Also, can a Mac person suggest a good free text editor to
        >>use in writing the code.
        >
        >
      • Fortuno, Adam
        Augustine, Alright Mac brother, lets roll up our sleeves and do a little MacOS X commandline/Perl 101. All Mac s ship with Perl. If you re running Panther, you
        Message 3 of 19 , Feb 4 6:21 AM
        • 0 Attachment
          Augustine,

          Alright Mac brother, lets roll up our sleeves and do a little MacOS X
          commandline/Perl 101.

          All Mac's ship with Perl. If you're running Panther, you have Perl 5.8.1 (by
          default). If you're running Jaguar, you have Perl 5.6.0 (by default). Like
          John said, don't worry about where Perl is on your workstation. The
          operating system is smart enough to know where Perl is (investigate the Path
          if your interested in how it does this). If you ever doubt that Perl is on
          your Mac, type `Perl -v` at the commandline. You will see version
          information for your build of Perl.

          As for your code, here is my feedback (my comments are prefixed with **).

          === CODE: Original w/comments ===

          #!/usr/bin/perl -w

          $DNA = 'AACGGTATGACTGAACGCGGTAGC';

          ** The print function is `print` not `PRINT`, case matters.
          PRINT DNA;

          EXIT;

          Ultimately, I know you're doing an excersie, but it would give me a warm
          fuzzy if you just wrote:

          === CODE: Suggested ===

          #! /usr/bin/perl
          print('AACGGTATGACTGAACGCGGTAGC');

          I assume you're working at the commandline and not through Aqua. Keep in
          mind, your running this in Unix. After you creat the file with the code in
          it. You need to change the files permissions to allow you to RUN the script.
          To do this, get a handy Unix how-to book, or blindly follow my advice: chmod
          u+x <file_name> (e.g. chmod u+x test.pl). If you don't do this, when you
          attempt to run the script you will get a permission error.

          Texteditors! You're going to start an old fashion brawl with this question.
          On X, you've choices that include:
          - X Code (Panther only)
          - Project Builder (Jaguar and 10.1.x)
          - BBEdit
          - VIM
          - EMACS

          I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
          Project Builder. Project Builder is provided free of charge by Apple. Its a
          robust text editor for use in Aqua. VIM executes from the shell. Its tough
          to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
          you'll find it all over, and its very helpful. For you, I recommend Project
          Builder, but once you've got a better handle on Perl take the time to work
          in VIM.

          Regards,
          Adam

          F.Y.I: Mac specific Perl help try the OS X Perl list->
          http://lists.cpan.org/showlist.cgi?name=macosx (Don't let Randall know I'm
          pushing the web again)

          -----Original Message-----
          From: wadunn83 [mailto:wadunn83@...]
          Sent: Tuesday, February 03, 2004 5:15 PM
          To: perl-beginner@yahoogroups.com
          Subject: [PBML] Mac OS X terminal question


          First: thanks again for all the help in picking a book.

          Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
          type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
          am completely failing. Can a fellow Mac Perl-er help me out with the
          logistics of where to write the code, where to save it, and how to
          tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
          about to shatter my poor computer screen. I am getting the coding
          ideas I just cant figure out the system. Thank you all for your
          patience. Also, can a Mac person suggest a good free text editor to
          use in writing the code.


          -Augustine

          FYI the code is:

          #!/usr/bin/perl -w
          $DNA = 'AACGGTATGACTGAACGCGGTAGC';

          PRINT DNA;

          EXIT;
        • Peter Dominey
          ... Jeff, Wonderfully MAC OS X is really UNIX. So from a terminal you can follow pretty much all the rules and instructions for using and working with PERL on
          Message 4 of 19 , Feb 4 7:43 AM
          • 0 Attachment
            --- Jeff Eggen <jeggen@...> wrote:
            > >>> wadunn83@... 02/03/04 04:15pm >>>
            > >Now: I bought Tisdall's Beg Perl for
            > Bioinformatics. I am trying to
            > >type and run a SIMPLE example in my Mac OS 10.2.x
            > Unix terminal and I
            > >am completely failing. Can a fellow Mac Perl-er
            > help me out with the
            > >logistics of where to write the code, where to save
            > it, and how to
            > >tell my computer to run it. I KNOW THIS IS BELOW
            > you all, but I am
            > >about to shatter my poor computer screen. I am
            > getting the coding
            > >ideas I just cant figure out the system. Thank you
            > all for your
            > >patience. Also, can a Mac person suggest a good
            > free text editor to
            > >use in writing the code.
            >
            > Doesn't Mac OSX come with vi? What could be better?
            >
            > Ooh, I'm gonna take heat for that one.
            >
            > Seriously, though, if there is a Notepad-like editor
            > that lets you save simple text files, you can just
            > use that to code. Or, a search on google for
            > editors would probably turn up something.
            >
            > >-Augustine
            >
            > >FYI the code is:
            >
            > >#!/usr/bin/perl -w
            > >$DNA = 'AACGGTATGACTGAACGCGGTAGC';
            >
            > >PRINT DNA;
            >
            > >EXIT;
            >
            > Is your code actually this case? In caps, I mean.
            > If so, it won't run. Try this:
            >
            > #!/usr/bin/perl -w
            >
            > use strict; # Very necessary for a newbie!!
            >
            > my $DNA = 'AACGGTATGACTGAACGCGGTAGC';
            >
            > print $DNA, "\n"; # You need the dollar sign
            > exit;
            >
            > I'm unfamiliar with Mac OSX workings, but if you
            > have some kind of command shell that is anything
            > like unix, just try to run the script via the
            > following commands:
            >
            > First, make it executable:
            > chmod u+x yourscript.pl
            >
            > Then, run it:
            > ./yourscript.pl
            >
            > If it isn't, then you can ignore that bit.
            >
            > If you are attempting to run your script and getting
            > errors, post the errors so we know where to help
            > you.
            >

            Jeff,

            Wonderfully MAC OS X is really UNIX. So from a
            terminal you can follow pretty much all the rules and
            instructions for using and working with PERL on UNIX.

            The vi editor is available on OS X and I find it as
            quick and easy to use as anything else. Certainly
            while in a terminal it's so much quicker than opening
            up seperate apps.

            The first rule to follow ism know where perl is
            instaalled, do the command 'which perl' to tell you
            where it is located it'll be something like
            /usr/bin/perl or maybe /usr/local/bin/perl. This is
            what you need at the top of your script following the
            #!

            Next, for ease of use make sure your currect directory
            is in you PATH. so enter the command PATH=$PATH:.
            This will append the 'current' directory to you path
            and therefore 'find' any executable (script etc)) in
            your current dir (after searching the previous
            directories defined in the PATH variable). It's worth
            noting however that the command above is only valid
            for the time you have that particula terminal session
            open. For it to be configured for everytime you open a
            terminal you'll need to change one or two other file.
            But that a whole different topic.

            Hope this is of assitance.

            Thanks
            Peter


            =====
            **********************************************************
            P J Dominey
            Independent UNIX Contractor

            E-Mail: pdominey@...
            Web Site: www.dominey.biz
            Tel: 972-424-5705 Yahoo IM: pdominey
            **********************************************************

            __________________________________
            Do you Yahoo!?
            Yahoo! SiteBuilder - Free web site building tool. Try it!
            http://webhosting.yahoo.com/ps/sb/
          • Maria K Meyers
            ... Nothing is better than vi. Vi is the best editor in the world. I am a loyal unix user. I love vi. Ah, vi. Vi. ~Maria
            Message 5 of 19 , Feb 4 9:00 AM
            • 0 Attachment
              >Doesn't Mac OSX come with vi? What could be better?

              >Ooh, I'm gonna take heat for that one.

              Nothing is better than vi.
              Vi is the best editor in the world.
              I am a loyal unix user.
              I love vi.
              Ah, vi.
              Vi.

              ~Maria
            • painter_man
              ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
              Message 6 of 19 , Feb 4 9:07 AM
              • 0 Attachment
                --- In perl-beginner@yahoogroups.com, "Maria K Meyers" <mmeyer4@h...>
                wrote:
                >
                > >Doesn't Mac OSX come with vi? What could be better?
                >
                > >Ooh, I'm gonna take heat for that one.
                >
                > Nothing is better than vi.
                > Vi is the best editor in the world.
                > I am a loyal unix user.
                > I love vi.
                > Ah, vi.
                > Vi.
                >
                > ~Maria

                Vi is an emacs macro to hide the power of a real editor from those
                who are not yet ready for it.
                <grins and returns to temple to wait for another novice>
                LOL
              • Maria K Meyers
                ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
                Message 7 of 19 , Feb 4 9:22 AM
                • 0 Attachment
                  >
                  > Nothing is better than vi.
                  > Vi is the best editor in the world.
                  > I am a loyal unix user.
                  > I love vi.
                  > Ah, vi.
                  > Vi.
                  >
                  > ~Maria

                  Vi is an emacs macro to hide the power of a real editor from those
                  who are not yet ready for it.
                  <grins and returns to temple to wait for another novice>
                  LOL


                  ****
                  Oh great and wise one, how might I be ever deemed to learned such
                  greatness?
                  All praise the great one.
                  I will however contine in my ignorance with the blissful use of vi.
                  Ah, vi.

                  LMAO
                • Paul Archer
                  ... From the VI lovers page (www.thomer.com/vi/vi.html): Don t get me wrong: Emacs is a great operating system--it lacks a good editor, though. Paul That
                  Message 8 of 19 , Feb 4 11:45 AM
                  • 0 Attachment
                    > > >Doesn't Mac OSX come with vi? What could be better?
                    > >
                    > > >Ooh, I'm gonna take heat for that one.
                    > >
                    > > Nothing is better than vi.
                    > > Vi is the best editor in the world.
                    > > I am a loyal unix user.
                    > > I love vi.
                    > > Ah, vi.
                    > > Vi.
                    > >
                    > > ~Maria
                    >
                    > Vi is an emacs macro to hide the power of a real editor from those
                    > who are not yet ready for it.


                    From the VI lovers' page (www.thomer.com/vi/vi.html):

                    Don't get me wrong: Emacs is a great operating system--it lacks a good
                    editor, though.


                    Paul "That 'Six' editor is great!" Archer
                  • Paul Archer
                    ... I would add jEdit to that list. It s Java-based, so you have to have a JVM (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
                    Message 9 of 19 , Feb 4 4:25 PM
                    • 0 Attachment
                      9:21am, Fortuno, Adam wrote:

                      > Texteditors! You're going to start an old fashion brawl with this question.
                      > On X, you've choices that include:
                      > - X Code (Panther only)
                      > - Project Builder (Jaguar and 10.1.x)
                      > - BBEdit
                      > - VIM
                      > - EMACS
                      >
                      > I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
                      > Project Builder. Project Builder is provided free of charge by Apple. Its a
                      > robust text editor for use in Aqua. VIM executes from the shell. Its tough
                      > to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
                      > you'll find it all over, and its very helpful. For you, I recommend Project
                      > Builder, but once you've got a better handle on Perl take the time to work
                      > in VIM.
                      >

                      I would add jEdit to that list. It's Java-based, so you have to have a JVM
                      (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
                      www.sun.com/java to get a JVM.
                      Anyway, jEdit is free, easy to use, and one file installs and runs on Mac,
                      Windows, and pretty much any Unix you care to name (Linux, Solaris, *BSD,
                      etc). www.jedit.org

                      Paul


                      -------------------------------------------
                      I judge a religion as being good or bad
                      based on whether its adherents become
                      better people as a result of practicing it.
                      - Joe Mullally, computer salesman
                      -------------------------------------------
                    • merlyn@stonehenge.com
                      ... Adam Like John said, don t worry about where Perl is on your Adam workstation. Uh, you have to worry, because the #! line has to be correct. Adam The
                      Message 10 of 19 , Feb 5 2:35 AM
                      • 0 Attachment
                        >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                        Adam> Like John said, don't worry about where Perl is on your
                        Adam> workstation.

                        Uh, you have to worry, because the #! line has to be correct.

                        Adam> The operating system is smart enough to know where Perl is
                        Adam> (investigate the Path if your interested in how it does this).

                        No, it's not.

                        Adam> If you ever doubt that Perl is on
                        Adam> your Mac, type `Perl -v` at the commandline.

                        No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.





                        Remember, when you post a wrong answer, I have to spend time fixing
                        the incorrect answer, instead of answering a new question.

                        Please consider that if you're less experienced. Doublecheck your
                        facts before you post.

                        --
                        Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                        <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                        Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                        See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
                      • Fortuno, Adam
                        Can t argue with that. What he said. ... From: merlyn@stonehenge.com [mailto:merlyn@stonehenge.com] Sent: Thursday, February 05, 2004 5:35 AM To:
                        Message 11 of 19 , Feb 5 5:28 AM
                        • 0 Attachment
                          Can't argue with that. What he said.

                          -----Original Message-----
                          From: merlyn@... [mailto:merlyn@...]
                          Sent: Thursday, February 05, 2004 5:35 AM
                          To: perl-beginner@yahoogroups.com
                          Subject: Re: [PBML] Mac OS X terminal question


                          >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                          Adam> Like John said, don't worry about where Perl is on your
                          Adam> workstation.

                          Uh, you have to worry, because the #! line has to be correct.

                          Adam> The operating system is smart enough to know where Perl is
                          Adam> (investigate the Path if your interested in how it does this).

                          No, it's not.

                          Adam> If you ever doubt that Perl is on
                          Adam> your Mac, type `Perl -v` at the commandline.

                          No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.





                          Remember, when you post a wrong answer, I have to spend time fixing
                          the incorrect answer, instead of answering a new question.

                          Please consider that if you're less experienced. Doublecheck your
                          facts before you post.

                          --
                          Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                          <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                          Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                          See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl
                          training!



                          Unsubscribing info is here:
                          http://help.yahoo.com/help/us/groups/groups-32.html
                          Yahoo! Groups Links
                        • Fortuno, Adam
                          Peter, I think you can still get jEdit through Apple s site too (see URL at the bottom of the page).
                          Message 12 of 19 , Feb 5 5:37 AM
                          • 0 Attachment
                            Peter,

                            I think you can still get jEdit through Apple's site too (see URL at the
                            bottom of the page).

                            http://www.apple.com/downloads/macosx/development_tools/jedit.html

                            Regards,
                            Adam

                            -----Original Message-----
                            From: Peter Dominey [mailto:pdominey@...]
                            Sent: Wednesday, February 04, 2004 10:44 AM
                            To: perl-beginner@yahoogroups.com
                            Subject: Re: [PBML] Mac OS X terminal question



                            --- Jeff Eggen <jeggen@...> wrote:
                            > >>> wadunn83@... 02/03/04 04:15pm >>>
                            > >Now: I bought Tisdall's Beg Perl for
                            > Bioinformatics. I am trying to
                            > >type and run a SIMPLE example in my Mac OS 10.2.x
                            > Unix terminal and I
                            > >am completely failing. Can a fellow Mac Perl-er
                            > help me out with the
                            > >logistics of where to write the code, where to save
                            > it, and how to
                            > >tell my computer to run it. I KNOW THIS IS BELOW
                            > you all, but I am
                            > >about to shatter my poor computer screen. I am
                            > getting the coding
                            > >ideas I just cant figure out the system. Thank you
                            > all for your
                            > >patience. Also, can a Mac person suggest a good
                            > free text editor to
                            > >use in writing the code.
                            >
                            > Doesn't Mac OSX come with vi? What could be better?
                            >
                            > Ooh, I'm gonna take heat for that one.
                            >
                            > Seriously, though, if there is a Notepad-like editor
                            > that lets you save simple text files, you can just
                            > use that to code. Or, a search on google for
                            > editors would probably turn up something.
                            >
                            > >-Augustine
                            >
                            > >FYI the code is:
                            >
                            > >#!/usr/bin/perl -w
                            > >$DNA = 'AACGGTATGACTGAACGCGGTAGC';
                            >
                            > >PRINT DNA;
                            >
                            > >EXIT;
                            >
                            > Is your code actually this case? In caps, I mean.
                            > If so, it won't run. Try this:
                            >
                            > #!/usr/bin/perl -w
                            >
                            > use strict; # Very necessary for a newbie!!
                            >
                            > my $DNA = 'AACGGTATGACTGAACGCGGTAGC';
                            >
                            > print $DNA, "\n"; # You need the dollar sign
                            > exit;
                            >
                            > I'm unfamiliar with Mac OSX workings, but if you
                            > have some kind of command shell that is anything
                            > like unix, just try to run the script via the
                            > following commands:
                            >
                            > First, make it executable:
                            > chmod u+x yourscript.pl
                            >
                            > Then, run it:
                            > ./yourscript.pl
                            >
                            > If it isn't, then you can ignore that bit.
                            >
                            > If you are attempting to run your script and getting
                            > errors, post the errors so we know where to help
                            > you.
                            >

                            Jeff,

                            Wonderfully MAC OS X is really UNIX. So from a
                            terminal you can follow pretty much all the rules and
                            instructions for using and working with PERL on UNIX.

                            The vi editor is available on OS X and I find it as
                            quick and easy to use as anything else. Certainly
                            while in a terminal it's so much quicker than opening
                            up seperate apps.

                            The first rule to follow ism know where perl is
                            instaalled, do the command 'which perl' to tell you
                            where it is located it'll be something like
                            /usr/bin/perl or maybe /usr/local/bin/perl. This is
                            what you need at the top of your script following the
                            #!

                            Next, for ease of use make sure your currect directory
                            is in you PATH. so enter the command PATH=$PATH:.
                            This will append the 'current' directory to you path
                            and therefore 'find' any executable (script etc)) in
                            your current dir (after searching the previous
                            directories defined in the PATH variable). It's worth
                            noting however that the command above is only valid
                            for the time you have that particula terminal session
                            open. For it to be configured for everytime you open a
                            terminal you'll need to change one or two other file.
                            But that a whole different topic.

                            Hope this is of assitance.

                            Thanks
                            Peter


                            =====
                            **********************************************************
                            P J Dominey
                            Independent UNIX Contractor

                            E-Mail: pdominey@...
                            Web Site: www.dominey.biz
                            Tel: 972-424-5705 Yahoo IM: pdominey
                            **********************************************************

                            __________________________________
                            Do you Yahoo!?
                            Yahoo! SiteBuilder - Free web site building tool. Try it!
                            http://webhosting.yahoo.com/ps/sb/

                            Unsubscribing info is here:
                            http://help.yahoo.com/help/us/groups/groups-32.html

                            Yahoo! Groups Links

                            To visit your group on the web, go to:
                            http://groups.yahoo.com/group/perl-beginner/

                            To unsubscribe from this group, send an email to:
                            perl-beginner-unsubscribe@yahoogroups.com

                            Your use of Yahoo! Groups is subject to:
                            http://docs.yahoo.com/info/terms/
                          • Peter Dominey
                            ... http://www.apple.com/downloads/macosx/development_tools/jedit.html ... Adam, I m pretty sure you are right. I m just an old dyed-the-wool UNIX guy so tend
                            Message 13 of 19 , Feb 5 5:59 AM
                            • 0 Attachment
                              --- "Fortuno, Adam" <fortunoa@...> wrote:
                              > Peter,
                              >
                              > I think you can still get jEdit through Apple's site
                              > too (see URL at the
                              > bottom of the page).
                              >
                              >
                              http://www.apple.com/downloads/macosx/development_tools/jedit.html
                              >
                              > Regards,
                              > Adam
                              >

                              Adam,

                              I'm pretty sure you are right. I'm just an old
                              dyed-the-wool UNIX guy so tend to stick with ed or vi
                              (although these days vim as a replacement of 'real'
                              vi) :)

                              Ofcourse as a UNIX by preference person, I'm just over
                              the moon at Apple moving to it and now of course
                              Novell doing the same thing.

                              Tks
                              Pete


                              =====
                              **********************************************************
                              P J Dominey
                              Independent UNIX Contractor

                              E-Mail: pdominey@...
                              Web Site: www.dominey.biz
                              Tel: 972-424-5705 Yahoo IM: pdominey
                              **********************************************************

                              __________________________________
                              Do you Yahoo!?
                              Yahoo! Finance: Get your refund fast by filing online.
                              http://taxes.yahoo.com/filing.html
                            • Fortuno, Adam
                              Peter, I like VI too. I m just a text editor slut so I go between VI and XCode fairly often. Regarding what you said about OS X, I empathize. The Unix/Mac
                              Message 14 of 19 , Feb 5 6:32 AM
                              • 0 Attachment
                                Peter,

                                I like VI too. I'm just a text editor slut so I go between VI and XCode
                                fairly often.

                                Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                                provided more synergies that I ever guessed. The platform's flexibility has
                                certainly leapt over preceding OS versions. I've had modest UNIX exposure
                                prior to X. However, working with X on a daily basis has given incentives to
                                do more work at the command line - for the most part its been fruitful. I
                                (as Randal pointed out) have a long way to go in-terms of learning, but the
                                impact on what I can do using my Mac has increased.

                                As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                                really-really slow on my G3 laptop so I ditched it.

                                Regards,
                                Adam

                                -----Original Message-----
                                From: Peter Dominey [mailto:pdominey@...]
                                Sent: Thursday, February 05, 2004 9:00 AM
                                To: perl-beginner@yahoogroups.com
                                Subject: RE: [PBML] Mac OS X terminal question


                                --- "Fortuno, Adam" <fortunoa@...> wrote:
                                > Peter,
                                >
                                > I think you can still get jEdit through Apple's site
                                > too (see URL at the
                                > bottom of the page).
                                >
                                >
                                http://www.apple.com/downloads/macosx/development_tools/jedit.html
                                >
                                > Regards,
                                > Adam
                                >

                                Adam,

                                I'm pretty sure you are right. I'm just an old
                                dyed-the-wool UNIX guy so tend to stick with ed or vi
                                (although these days vim as a replacement of 'real'
                                vi) :)

                                Ofcourse as a UNIX by preference person, I'm just over
                                the moon at Apple moving to it and now of course
                                Novell doing the same thing.

                                Tks
                                Pete


                                =====
                                **********************************************************
                                P J Dominey
                                Independent UNIX Contractor

                                E-Mail: pdominey@...
                                Web Site: www.dominey.biz
                                Tel: 972-424-5705 Yahoo IM: pdominey
                                **********************************************************

                                __________________________________
                                Do you Yahoo!?
                                Yahoo! Finance: Get your refund fast by filing online.
                                http://taxes.yahoo.com/filing.html


                                Unsubscribing info is here:
                                http://help.yahoo.com/help/us/groups/groups-32.html
                                Yahoo! Groups Links
                              • Rob Dowell
                                The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment)
                                Message 15 of 19 , Feb 5 6:52 AM
                                • 0 Attachment
                                  The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment) whenever I can though.

                                  "Fortuno, Adam" <fortunoa@...> wrote:Peter,

                                  I like VI too. I'm just a text editor slut so I go between VI and XCode
                                  fairly often.

                                  Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                                  provided more synergies that I ever guessed. The platform's flexibility has
                                  certainly leapt over preceding OS versions. I've had modest UNIX exposure
                                  prior to X. However, working with X on a daily basis has given incentives to
                                  do more work at the command line - for the most part its been fruitful. I
                                  (as Randal pointed out) have a long way to go in-terms of learning, but the
                                  impact on what I can do using my Mac has increased.

                                  As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                                  really-really slow on my G3 laptop so I ditched it.

                                  Regards,
                                  Adam

                                  -----Original Message-----
                                  From: Peter Dominey [mailto:pdominey@...]
                                  Sent: Thursday, February 05, 2004 9:00 AM
                                  To: perl-beginner@yahoogroups.com
                                  Subject: RE: [PBML] Mac OS X terminal question


                                  --- "Fortuno, Adam" <fortunoa@...> wrote:
                                  > Peter,
                                  >
                                  > I think you can still get jEdit through Apple's site
                                  > too (see URL at the
                                  > bottom of the page).
                                  >
                                  >
                                  http://www.apple.com/downloads/macosx/development_tools/jedit.html
                                  >
                                  > Regards,
                                  > Adam
                                  >

                                  Adam,

                                  I'm pretty sure you are right. I'm just an old
                                  dyed-the-wool UNIX guy so tend to stick with ed or vi
                                  (although these days vim as a replacement of 'real'
                                  vi) :)

                                  Ofcourse as a UNIX by preference person, I'm just over
                                  the moon at Apple moving to it and now of course
                                  Novell doing the same thing.

                                  Tks
                                  Pete


                                  =====
                                  **********************************************************
                                  P J Dominey
                                  Independent UNIX Contractor

                                  E-Mail: pdominey@...
                                  Web Site: www.dominey.biz
                                  Tel: 972-424-5705 Yahoo IM: pdominey
                                  **********************************************************

                                  __________________________________
                                  Do you Yahoo!?
                                  Yahoo! Finance: Get your refund fast by filing online.
                                  http://taxes.yahoo.com/filing.html


                                  Unsubscribing info is here:
                                  http://help.yahoo.com/help/us/groups/groups-32.html
                                  Yahoo! Groups Links






                                  Unsubscribing info is here: http://help.yahoo.com/help/us/groups/groups-32.html



                                  ---------------------------------
                                  Yahoo! Groups Links

                                  To visit your group on the web, go to:
                                  http://groups.yahoo.com/group/perl-beginner/

                                  To unsubscribe from this group, send an email to:
                                  perl-beginner-unsubscribe@yahoogroups.com

                                  Your use of Yahoo! Groups is subject to the Yahoo! Terms of Service.




                                  ---------------------------------
                                  Do you Yahoo!?
                                  Yahoo! Finance: Get your refund fast by filing online

                                  [Non-text portions of this message have been removed]
                                • Hans Ginzel
                                  ... Perl won the Linux Journal Editors Choice Award :-) http://www.linuxjournal.com/article.php?sid=6868 VIM is the Favorite Text Editor (Linux Journal
                                  Message 16 of 19 , Feb 5 8:41 AM
                                  • 0 Attachment
                                    On Wed, Feb 04, 2004 at 11:00:04AM -0600, Maria K Meyers wrote:
                                    > >Doesn't Mac OSX come with vi? What could be better?
                                    > Vi is the best editor in the world.

                                    Perl won the Linux Journal Editors' Choice Award :-)
                                    http://www.linuxjournal.com/article.php?sid=6868

                                    VIM is the Favorite Text Editor
                                    (Linux Journal Readers' Choice Awards) :-)
                                    http://www.linuxjournal.com/article.php?sid=7029

                                    Hans

                                    --
                                    PS: Wish for next version of perl:
                                    /--v(?-ersion)/ would be a shorthand for
                                    /--v(?:e(?:r(?:s(?:i(?:on?)?)?)?)?)?/
                                  • merlyn@stonehenge.com
                                    ... Hans VIM is the Favorite Text Editor Hans (Linux Journal Readers Choice Awards) :-) Hans http://www.linuxjournal.com/article.php?sid=7029 ooh, this is
                                    Message 17 of 19 , Feb 5 9:02 AM
                                    • 0 Attachment
                                      >>>>> "Hans" == Hans Ginzel <hans@...> writes:

                                      Hans> VIM is the Favorite Text Editor
                                      Hans> (Linux Journal Readers' Choice Awards) :-)
                                      Hans> http://www.linuxjournal.com/article.php?sid=7029

                                      ooh, this is so obviously biased! I demand a florida-style recount!
                                      Over and over. In fact, I can program my Emacs operating system
                                      to send email until it gets changed!

                                      --
                                      Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                                      <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                                      Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                                      See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
                                    • Jeff 'japhy' Pinyan
                                      ... Have you let the Perl Porters know? Sadly, you can t use (?-...), because (?-...) is reserved for turning off regex flags (so (?-i) turns off
                                      Message 18 of 19 , Feb 5 1:26 PM
                                      • 0 Attachment
                                        On Feb 5, Hans Ginzel said:

                                        >PS: Wish for next version of perl:
                                        >/--v(?-ersion)/ would be a shorthand for
                                        >/--v(?:e(?:r(?:s(?:i(?:on?)?)?)?)?)?/

                                        Have you let the Perl Porters know? Sadly, you can't use (?-...), because
                                        (?-...) is reserved for turning off regex flags (so (?-i) turns off
                                        case-insensitivity).

                                        However, (??ersion) seems appropriate to me, even if it looks a little
                                        noisy. I could add support for it in Regexp::Parser when I finish it.

                                        --
                                        Jeff "japhy" Pinyan japhy@... http://www.pobox.com/~japhy/
                                        RPI Acacia brother #734 http://www.perlmonks.org/ http://www.cpan.org/
                                        <stu> what does y/// stand for? <tenderpuss> why, yansliterate of course.
                                        [ I'm looking for programming work. If you like my work, let me know. ]
                                      Your message has been successfully submitted and would be delivered to recipients shortly.