Loading ...
Sorry, an error occurred while loading the content.

Re: [PBML] Mac OS X terminal question

Expand Messages
  • Jeff Eggen
    ... Doesn t Mac OSX come with vi? What could be better? Ooh, I m gonna take heat for that one. Seriously, though, if there is a Notepad-like editor that lets
    Message 1 of 19 , Feb 3, 2004
      >>> wadunn83@... 02/03/04 04:15pm >>>
      >Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
      >type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
      >am completely failing. Can a fellow Mac Perl-er help me out with the
      >logistics of where to write the code, where to save it, and how to
      >tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
      >about to shatter my poor computer screen. I am getting the coding
      >ideas I just cant figure out the system. Thank you all for your
      >patience. Also, can a Mac person suggest a good free text editor to
      >use in writing the code.

      Doesn't Mac OSX come with vi? What could be better?

      Ooh, I'm gonna take heat for that one.

      Seriously, though, if there is a Notepad-like editor that lets you save simple text files, you can just use that to code. Or, a search on google for editors would probably turn up something.


      >FYI the code is:

      >#!/usr/bin/perl -w

      >PRINT DNA;


      Is your code actually this case? In caps, I mean. If so, it won't run. Try this:

      #!/usr/bin/perl -w

      use strict; # Very necessary for a newbie!!


      print $DNA, "\n"; # You need the dollar sign

      I'm unfamiliar with Mac OSX workings, but if you have some kind of command shell that is anything like unix, just try to run the script via the following commands:

      First, make it executable:
      chmod u+x yourscript.pl

      Then, run it:

      If it isn't, then you can ignore that bit.

      If you are attempting to run your script and getting errors, post the errors so we know where to help you.

      Hope this helps,

      Jeff Eggen
      IT Programmer Analyst
      Saskatchewan Government Insurance
      Ph (306) 751-1795
      email jeggen@...
    • franki
      A mac using friend of mine swears by pagespinner.. http://www.optima-system.com/pagespinner/ but OSX is based on freeBSD so anything that works on that can
      Message 2 of 19 , Feb 3, 2004
        A mac using friend of mine swears by pagespinner..

        but OSX is based on freeBSD so anything that works on that can usually
        be made to work on OSX and most have packages already made for you..
        (google is your friend.)

        hmmm, unix type text editors... the list is very long, I spose the most
        well known would be vi and emacs.. but there are about 3 dozen others..

        Unix users are very loyal to their text editors, so when you choose one,
        be careful who you tell about your choice :-)



        Jeff Eggen wrote:

        >>>>wadunn83@... 02/03/04 04:15pm >>>
        >>Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
        >>type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
        >>am completely failing. Can a fellow Mac Perl-er help me out with the
        >>logistics of where to write the code, where to save it, and how to
        >>tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
        >>about to shatter my poor computer screen. I am getting the coding
        >>ideas I just cant figure out the system. Thank you all for your
        >>patience. Also, can a Mac person suggest a good free text editor to
        >>use in writing the code.
      • John S Brigham
        I am just a little ahead of you and may be helpful. --The CPAN installs the Perl in some mysterious way according to specifications that probably few people
        Message 3 of 19 , Feb 3, 2004
          I am just a little ahead of you and may be helpful.
          --The CPAN installs the Perl in some mysterious way according to
          specifications that probably few people understand, certainly not me.
          But it does not matter, don't worry.
          --write the Perl script and save it in a directory.
          --in DOS, navigate to the directory with the script. You do not care
          where the Perl stuff is. On my computer, the Perl is on the other hard
          --type perl -c nameofscript.pl this will check the syntax The
          computer will find the Perl machinery.
          --then type perl -w nameofscript.pl this will run the script. .

          I love my Crimson Editor for Perl.
          I realize you have a Mac, but it cannot be that different.
          My advise: be persistant.
          John in Denver

          On Tue, 03 Feb 2004 22:15:16 -0000 "wadunn83" <wadunn83@...> writes:
          > First: thanks again for all the help in picking a book.
          > Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying
          > to
          > type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and
          > I
          > am completely failing. Can a fellow Mac Perl-er help me out with
          > the
          > logistics of where to write the code, where to save it, and how to
          > tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
          > about to shatter my poor computer screen. I am getting the coding
          > ideas I just cant figure out the system. Thank you all for your
          > patience. Also, can a Mac person suggest a good free text editor
          > to
          > use in writing the code.
          > -Augustine
          > FYI the code is:
          > #!/usr/bin/perl -w
          > PRINT DNA;
          > EXIT;
          > Unsubscribing info is here:
          > http://help.yahoo.com/help/us/groups/groups-32.html
          > ------------------------ Yahoo! Groups Sponsor
          > Yahoo! Groups Links
          > To visit your group on the web, go to:
          > http://groups.yahoo.com/group/perl-beginner/
          > To unsubscribe from this group, send an email to:
          > perl-beginner-unsubscribe@yahoogroups.com
          > Your use of Yahoo! Groups is subject to:
          > http://docs.yahoo.com/info/terms/

          The best thing to hit the Internet in years - Juno SpeedBand!
          Surf the Web up to FIVE TIMES FASTER!
          Only $14.95/ month - visit www.juno.com to sign up today!
        • Fortuno, Adam
          Augustine, Alright Mac brother, lets roll up our sleeves and do a little MacOS X commandline/Perl 101. All Mac s ship with Perl. If you re running Panther, you
          Message 4 of 19 , Feb 4, 2004

            Alright Mac brother, lets roll up our sleeves and do a little MacOS X
            commandline/Perl 101.

            All Mac's ship with Perl. If you're running Panther, you have Perl 5.8.1 (by
            default). If you're running Jaguar, you have Perl 5.6.0 (by default). Like
            John said, don't worry about where Perl is on your workstation. The
            operating system is smart enough to know where Perl is (investigate the Path
            if your interested in how it does this). If you ever doubt that Perl is on
            your Mac, type `Perl -v` at the commandline. You will see version
            information for your build of Perl.

            As for your code, here is my feedback (my comments are prefixed with **).

            === CODE: Original w/comments ===

            #!/usr/bin/perl -w


            ** The print function is `print` not `PRINT`, case matters.
            PRINT DNA;


            Ultimately, I know you're doing an excersie, but it would give me a warm
            fuzzy if you just wrote:

            === CODE: Suggested ===

            #! /usr/bin/perl

            I assume you're working at the commandline and not through Aqua. Keep in
            mind, your running this in Unix. After you creat the file with the code in
            it. You need to change the files permissions to allow you to RUN the script.
            To do this, get a handy Unix how-to book, or blindly follow my advice: chmod
            u+x <file_name> (e.g. chmod u+x test.pl). If you don't do this, when you
            attempt to run the script you will get a permission error.

            Texteditors! You're going to start an old fashion brawl with this question.
            On X, you've choices that include:
            - X Code (Panther only)
            - Project Builder (Jaguar and 10.1.x)
            - BBEdit
            - VIM
            - EMACS

            I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
            Project Builder. Project Builder is provided free of charge by Apple. Its a
            robust text editor for use in Aqua. VIM executes from the shell. Its tough
            to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
            you'll find it all over, and its very helpful. For you, I recommend Project
            Builder, but once you've got a better handle on Perl take the time to work
            in VIM.


            F.Y.I: Mac specific Perl help try the OS X Perl list->
            http://lists.cpan.org/showlist.cgi?name=macosx (Don't let Randall know I'm
            pushing the web again)

            -----Original Message-----
            From: wadunn83 [mailto:wadunn83@...]
            Sent: Tuesday, February 03, 2004 5:15 PM
            To: perl-beginner@yahoogroups.com
            Subject: [PBML] Mac OS X terminal question

            First: thanks again for all the help in picking a book.

            Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
            type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
            am completely failing. Can a fellow Mac Perl-er help me out with the
            logistics of where to write the code, where to save it, and how to
            tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
            about to shatter my poor computer screen. I am getting the coding
            ideas I just cant figure out the system. Thank you all for your
            patience. Also, can a Mac person suggest a good free text editor to
            use in writing the code.


            FYI the code is:

            #!/usr/bin/perl -w

            PRINT DNA;

          • Peter Dominey
            ... Jeff, Wonderfully MAC OS X is really UNIX. So from a terminal you can follow pretty much all the rules and instructions for using and working with PERL on
            Message 5 of 19 , Feb 4, 2004
              --- Jeff Eggen <jeggen@...> wrote:
              > >>> wadunn83@... 02/03/04 04:15pm >>>
              > >Now: I bought Tisdall's Beg Perl for
              > Bioinformatics. I am trying to
              > >type and run a SIMPLE example in my Mac OS 10.2.x
              > Unix terminal and I
              > >am completely failing. Can a fellow Mac Perl-er
              > help me out with the
              > >logistics of where to write the code, where to save
              > it, and how to
              > >tell my computer to run it. I KNOW THIS IS BELOW
              > you all, but I am
              > >about to shatter my poor computer screen. I am
              > getting the coding
              > >ideas I just cant figure out the system. Thank you
              > all for your
              > >patience. Also, can a Mac person suggest a good
              > free text editor to
              > >use in writing the code.
              > Doesn't Mac OSX come with vi? What could be better?
              > Ooh, I'm gonna take heat for that one.
              > Seriously, though, if there is a Notepad-like editor
              > that lets you save simple text files, you can just
              > use that to code. Or, a search on google for
              > editors would probably turn up something.
              > >-Augustine
              > >FYI the code is:
              > >#!/usr/bin/perl -w
              > >PRINT DNA;
              > >EXIT;
              > Is your code actually this case? In caps, I mean.
              > If so, it won't run. Try this:
              > #!/usr/bin/perl -w
              > use strict; # Very necessary for a newbie!!
              > print $DNA, "\n"; # You need the dollar sign
              > exit;
              > I'm unfamiliar with Mac OSX workings, but if you
              > have some kind of command shell that is anything
              > like unix, just try to run the script via the
              > following commands:
              > First, make it executable:
              > chmod u+x yourscript.pl
              > Then, run it:
              > ./yourscript.pl
              > If it isn't, then you can ignore that bit.
              > If you are attempting to run your script and getting
              > errors, post the errors so we know where to help
              > you.


              Wonderfully MAC OS X is really UNIX. So from a
              terminal you can follow pretty much all the rules and
              instructions for using and working with PERL on UNIX.

              The vi editor is available on OS X and I find it as
              quick and easy to use as anything else. Certainly
              while in a terminal it's so much quicker than opening
              up seperate apps.

              The first rule to follow ism know where perl is
              instaalled, do the command 'which perl' to tell you
              where it is located it'll be something like
              /usr/bin/perl or maybe /usr/local/bin/perl. This is
              what you need at the top of your script following the

              Next, for ease of use make sure your currect directory
              is in you PATH. so enter the command PATH=$PATH:.
              This will append the 'current' directory to you path
              and therefore 'find' any executable (script etc)) in
              your current dir (after searching the previous
              directories defined in the PATH variable). It's worth
              noting however that the command above is only valid
              for the time you have that particula terminal session
              open. For it to be configured for everytime you open a
              terminal you'll need to change one or two other file.
              But that a whole different topic.

              Hope this is of assitance.


              P J Dominey
              Independent UNIX Contractor

              E-Mail: pdominey@...
              Web Site: www.dominey.biz
              Tel: 972-424-5705 Yahoo IM: pdominey

              Do you Yahoo!?
              Yahoo! SiteBuilder - Free web site building tool. Try it!
            • Maria K Meyers
              ... Nothing is better than vi. Vi is the best editor in the world. I am a loyal unix user. I love vi. Ah, vi. Vi. ~Maria
              Message 6 of 19 , Feb 4, 2004
                >Doesn't Mac OSX come with vi? What could be better?

                >Ooh, I'm gonna take heat for that one.

                Nothing is better than vi.
                Vi is the best editor in the world.
                I am a loyal unix user.
                I love vi.
                Ah, vi.

              • painter_man
                ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
                Message 7 of 19 , Feb 4, 2004
                  --- In perl-beginner@yahoogroups.com, "Maria K Meyers" <mmeyer4@h...>
                  > >Doesn't Mac OSX come with vi? What could be better?
                  > >Ooh, I'm gonna take heat for that one.
                  > Nothing is better than vi.
                  > Vi is the best editor in the world.
                  > I am a loyal unix user.
                  > I love vi.
                  > Ah, vi.
                  > Vi.
                  > ~Maria

                  Vi is an emacs macro to hide the power of a real editor from those
                  who are not yet ready for it.
                  <grins and returns to temple to wait for another novice>
                • Maria K Meyers
                  ... Vi is an emacs macro to hide the power of a real editor from those who are not yet ready for it.
                  Message 8 of 19 , Feb 4, 2004
                    > Nothing is better than vi.
                    > Vi is the best editor in the world.
                    > I am a loyal unix user.
                    > I love vi.
                    > Ah, vi.
                    > Vi.
                    > ~Maria

                    Vi is an emacs macro to hide the power of a real editor from those
                    who are not yet ready for it.
                    <grins and returns to temple to wait for another novice>

                    Oh great and wise one, how might I be ever deemed to learned such
                    All praise the great one.
                    I will however contine in my ignorance with the blissful use of vi.
                    Ah, vi.

                  • Paul Archer
                    ... From the VI lovers page (www.thomer.com/vi/vi.html): Don t get me wrong: Emacs is a great operating system--it lacks a good editor, though. Paul That
                    Message 9 of 19 , Feb 4, 2004
                      > > >Doesn't Mac OSX come with vi? What could be better?
                      > >
                      > > >Ooh, I'm gonna take heat for that one.
                      > >
                      > > Nothing is better than vi.
                      > > Vi is the best editor in the world.
                      > > I am a loyal unix user.
                      > > I love vi.
                      > > Ah, vi.
                      > > Vi.
                      > >
                      > > ~Maria
                      > Vi is an emacs macro to hide the power of a real editor from those
                      > who are not yet ready for it.

                      From the VI lovers' page (www.thomer.com/vi/vi.html):

                      Don't get me wrong: Emacs is a great operating system--it lacks a good
                      editor, though.

                      Paul "That 'Six' editor is great!" Archer
                    • Paul Archer
                      ... I would add jEdit to that list. It s Java-based, so you have to have a JVM (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
                      Message 10 of 19 , Feb 4, 2004
                        9:21am, Fortuno, Adam wrote:

                        > Texteditors! You're going to start an old fashion brawl with this question.
                        > On X, you've choices that include:
                        > - X Code (Panther only)
                        > - Project Builder (Jaguar and 10.1.x)
                        > - BBEdit
                        > - VIM
                        > - EMACS
                        > I use VIM and X Code but I'm running Panther. For you, I suggest VIM or
                        > Project Builder. Project Builder is provided free of charge by Apple. Its a
                        > robust text editor for use in Aqua. VIM executes from the shell. Its tough
                        > to learn but easy to use (kinda like Perl). Once you're adjusted to VIM
                        > you'll find it all over, and its very helpful. For you, I recommend Project
                        > Builder, but once you've got a better handle on Perl take the time to work
                        > in VIM.

                        I would add jEdit to that list. It's Java-based, so you have to have a JVM
                        (Java Virtual Machine). Dunno if OS X comes with, but you can always go to
                        www.sun.com/java to get a JVM.
                        Anyway, jEdit is free, easy to use, and one file installs and runs on Mac,
                        Windows, and pretty much any Unix you care to name (Linux, Solaris, *BSD,
                        etc). www.jedit.org


                        I judge a religion as being good or bad
                        based on whether its adherents become
                        better people as a result of practicing it.
                        - Joe Mullally, computer salesman
                      • merlyn@stonehenge.com
                        ... Adam Like John said, don t worry about where Perl is on your Adam workstation. Uh, you have to worry, because the #! line has to be correct. Adam The
                        Message 11 of 19 , Feb 5, 2004
                          >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                          Adam> Like John said, don't worry about where Perl is on your
                          Adam> workstation.

                          Uh, you have to worry, because the #! line has to be correct.

                          Adam> The operating system is smart enough to know where Perl is
                          Adam> (investigate the Path if your interested in how it does this).

                          No, it's not.

                          Adam> If you ever doubt that Perl is on
                          Adam> your Mac, type `Perl -v` at the commandline.

                          No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.

                          Remember, when you post a wrong answer, I have to spend time fixing
                          the incorrect answer, instead of answering a new question.

                          Please consider that if you're less experienced. Doublecheck your
                          facts before you post.

                          Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                          <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                          Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                          See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
                        • Fortuno, Adam
                          Can t argue with that. What he said. ... From: merlyn@stonehenge.com [mailto:merlyn@stonehenge.com] Sent: Thursday, February 05, 2004 5:35 AM To:
                          Message 12 of 19 , Feb 5, 2004
                            Can't argue with that. What he said.

                            -----Original Message-----
                            From: merlyn@... [mailto:merlyn@...]
                            Sent: Thursday, February 05, 2004 5:35 AM
                            To: perl-beginner@yahoogroups.com
                            Subject: Re: [PBML] Mac OS X terminal question

                            >>>>> "Adam" == Fortuno, Adam <fortunoa@...> writes:

                            Adam> Like John said, don't worry about where Perl is on your
                            Adam> workstation.

                            Uh, you have to worry, because the #! line has to be correct.

                            Adam> The operating system is smart enough to know where Perl is
                            Adam> (investigate the Path if your interested in how it does this).

                            No, it's not.

                            Adam> If you ever doubt that Perl is on
                            Adam> your Mac, type `Perl -v` at the commandline.

                            No, you mean "perl -v". Case sensitive for commands. That's 3 for 3. Ugh.

                            Remember, when you post a wrong answer, I have to spend time fixing
                            the incorrect answer, instead of answering a new question.

                            Please consider that if you're less experienced. Doublecheck your
                            facts before you post.

                            Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                            <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                            Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                            See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl

                            Unsubscribing info is here:
                            Yahoo! Groups Links
                          • Fortuno, Adam
                            Peter, I think you can still get jEdit through Apple s site too (see URL at the bottom of the page).
                            Message 13 of 19 , Feb 5, 2004

                              I think you can still get jEdit through Apple's site too (see URL at the
                              bottom of the page).



                              -----Original Message-----
                              From: Peter Dominey [mailto:pdominey@...]
                              Sent: Wednesday, February 04, 2004 10:44 AM
                              To: perl-beginner@yahoogroups.com
                              Subject: Re: [PBML] Mac OS X terminal question

                              --- Jeff Eggen <jeggen@...> wrote:
                              > >>> wadunn83@... 02/03/04 04:15pm >>>
                              > >Now: I bought Tisdall's Beg Perl for
                              > Bioinformatics. I am trying to
                              > >type and run a SIMPLE example in my Mac OS 10.2.x
                              > Unix terminal and I
                              > >am completely failing. Can a fellow Mac Perl-er
                              > help me out with the
                              > >logistics of where to write the code, where to save
                              > it, and how to
                              > >tell my computer to run it. I KNOW THIS IS BELOW
                              > you all, but I am
                              > >about to shatter my poor computer screen. I am
                              > getting the coding
                              > >ideas I just cant figure out the system. Thank you
                              > all for your
                              > >patience. Also, can a Mac person suggest a good
                              > free text editor to
                              > >use in writing the code.
                              > Doesn't Mac OSX come with vi? What could be better?
                              > Ooh, I'm gonna take heat for that one.
                              > Seriously, though, if there is a Notepad-like editor
                              > that lets you save simple text files, you can just
                              > use that to code. Or, a search on google for
                              > editors would probably turn up something.
                              > >-Augustine
                              > >FYI the code is:
                              > >#!/usr/bin/perl -w
                              > >$DNA = 'AACGGTATGACTGAACGCGGTAGC';
                              > >PRINT DNA;
                              > >EXIT;
                              > Is your code actually this case? In caps, I mean.
                              > If so, it won't run. Try this:
                              > #!/usr/bin/perl -w
                              > use strict; # Very necessary for a newbie!!
                              > my $DNA = 'AACGGTATGACTGAACGCGGTAGC';
                              > print $DNA, "\n"; # You need the dollar sign
                              > exit;
                              > I'm unfamiliar with Mac OSX workings, but if you
                              > have some kind of command shell that is anything
                              > like unix, just try to run the script via the
                              > following commands:
                              > First, make it executable:
                              > chmod u+x yourscript.pl
                              > Then, run it:
                              > ./yourscript.pl
                              > If it isn't, then you can ignore that bit.
                              > If you are attempting to run your script and getting
                              > errors, post the errors so we know where to help
                              > you.


                              Wonderfully MAC OS X is really UNIX. So from a
                              terminal you can follow pretty much all the rules and
                              instructions for using and working with PERL on UNIX.

                              The vi editor is available on OS X and I find it as
                              quick and easy to use as anything else. Certainly
                              while in a terminal it's so much quicker than opening
                              up seperate apps.

                              The first rule to follow ism know where perl is
                              instaalled, do the command 'which perl' to tell you
                              where it is located it'll be something like
                              /usr/bin/perl or maybe /usr/local/bin/perl. This is
                              what you need at the top of your script following the

                              Next, for ease of use make sure your currect directory
                              is in you PATH. so enter the command PATH=$PATH:.
                              This will append the 'current' directory to you path
                              and therefore 'find' any executable (script etc)) in
                              your current dir (after searching the previous
                              directories defined in the PATH variable). It's worth
                              noting however that the command above is only valid
                              for the time you have that particula terminal session
                              open. For it to be configured for everytime you open a
                              terminal you'll need to change one or two other file.
                              But that a whole different topic.

                              Hope this is of assitance.


                              P J Dominey
                              Independent UNIX Contractor

                              E-Mail: pdominey@...
                              Web Site: www.dominey.biz
                              Tel: 972-424-5705 Yahoo IM: pdominey

                              Do you Yahoo!?
                              Yahoo! SiteBuilder - Free web site building tool. Try it!

                              Unsubscribing info is here:

                              Yahoo! Groups Links

                              To visit your group on the web, go to:

                              To unsubscribe from this group, send an email to:

                              Your use of Yahoo! Groups is subject to:
                            • Peter Dominey
                              ... http://www.apple.com/downloads/macosx/development_tools/jedit.html ... Adam, I m pretty sure you are right. I m just an old dyed-the-wool UNIX guy so tend
                              Message 14 of 19 , Feb 5, 2004
                                --- "Fortuno, Adam" <fortunoa@...> wrote:
                                > Peter,
                                > I think you can still get jEdit through Apple's site
                                > too (see URL at the
                                > bottom of the page).
                                > Regards,
                                > Adam


                                I'm pretty sure you are right. I'm just an old
                                dyed-the-wool UNIX guy so tend to stick with ed or vi
                                (although these days vim as a replacement of 'real'
                                vi) :)

                                Ofcourse as a UNIX by preference person, I'm just over
                                the moon at Apple moving to it and now of course
                                Novell doing the same thing.


                                P J Dominey
                                Independent UNIX Contractor

                                E-Mail: pdominey@...
                                Web Site: www.dominey.biz
                                Tel: 972-424-5705 Yahoo IM: pdominey

                                Do you Yahoo!?
                                Yahoo! Finance: Get your refund fast by filing online.
                              • Fortuno, Adam
                                Peter, I like VI too. I m just a text editor slut so I go between VI and XCode fairly often. Regarding what you said about OS X, I empathize. The Unix/Mac
                                Message 15 of 19 , Feb 5, 2004

                                  I like VI too. I'm just a text editor slut so I go between VI and XCode
                                  fairly often.

                                  Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                                  provided more synergies that I ever guessed. The platform's flexibility has
                                  certainly leapt over preceding OS versions. I've had modest UNIX exposure
                                  prior to X. However, working with X on a daily basis has given incentives to
                                  do more work at the command line - for the most part its been fruitful. I
                                  (as Randal pointed out) have a long way to go in-terms of learning, but the
                                  impact on what I can do using my Mac has increased.

                                  As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                                  really-really slow on my G3 laptop so I ditched it.


                                  -----Original Message-----
                                  From: Peter Dominey [mailto:pdominey@...]
                                  Sent: Thursday, February 05, 2004 9:00 AM
                                  To: perl-beginner@yahoogroups.com
                                  Subject: RE: [PBML] Mac OS X terminal question

                                  --- "Fortuno, Adam" <fortunoa@...> wrote:
                                  > Peter,
                                  > I think you can still get jEdit through Apple's site
                                  > too (see URL at the
                                  > bottom of the page).
                                  > Regards,
                                  > Adam


                                  I'm pretty sure you are right. I'm just an old
                                  dyed-the-wool UNIX guy so tend to stick with ed or vi
                                  (although these days vim as a replacement of 'real'
                                  vi) :)

                                  Ofcourse as a UNIX by preference person, I'm just over
                                  the moon at Apple moving to it and now of course
                                  Novell doing the same thing.


                                  P J Dominey
                                  Independent UNIX Contractor

                                  E-Mail: pdominey@...
                                  Web Site: www.dominey.biz
                                  Tel: 972-424-5705 Yahoo IM: pdominey

                                  Do you Yahoo!?
                                  Yahoo! Finance: Get your refund fast by filing online.

                                  Unsubscribing info is here:
                                  Yahoo! Groups Links
                                • Rob Dowell
                                  The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment)
                                  Message 16 of 19 , Feb 5, 2004
                                    The overhead both on loading and running are my only complaints with Jedit. Other than that I tend to like it. Generally I use VIM (windows environment) whenever I can though.

                                    "Fortuno, Adam" <fortunoa@...> wrote:Peter,

                                    I like VI too. I'm just a text editor slut so I go between VI and XCode
                                    fairly often.

                                    Regarding what you said about OS X, I empathize. The Unix/Mac marriage has
                                    provided more synergies that I ever guessed. The platform's flexibility has
                                    certainly leapt over preceding OS versions. I've had modest UNIX exposure
                                    prior to X. However, working with X on a daily basis has given incentives to
                                    do more work at the command line - for the most part its been fruitful. I
                                    (as Randal pointed out) have a long way to go in-terms of learning, but the
                                    impact on what I can do using my Mac has increased.

                                    As far as jEdit, I used it when I first upgraded to X (10.1.x), but it was
                                    really-really slow on my G3 laptop so I ditched it.


                                    -----Original Message-----
                                    From: Peter Dominey [mailto:pdominey@...]
                                    Sent: Thursday, February 05, 2004 9:00 AM
                                    To: perl-beginner@yahoogroups.com
                                    Subject: RE: [PBML] Mac OS X terminal question

                                    --- "Fortuno, Adam" <fortunoa@...> wrote:
                                    > Peter,
                                    > I think you can still get jEdit through Apple's site
                                    > too (see URL at the
                                    > bottom of the page).
                                    > Regards,
                                    > Adam


                                    I'm pretty sure you are right. I'm just an old
                                    dyed-the-wool UNIX guy so tend to stick with ed or vi
                                    (although these days vim as a replacement of 'real'
                                    vi) :)

                                    Ofcourse as a UNIX by preference person, I'm just over
                                    the moon at Apple moving to it and now of course
                                    Novell doing the same thing.


                                    P J Dominey
                                    Independent UNIX Contractor

                                    E-Mail: pdominey@...
                                    Web Site: www.dominey.biz
                                    Tel: 972-424-5705 Yahoo IM: pdominey

                                    Do you Yahoo!?
                                    Yahoo! Finance: Get your refund fast by filing online.

                                    Unsubscribing info is here:
                                    Yahoo! Groups Links

                                    Unsubscribing info is here: http://help.yahoo.com/help/us/groups/groups-32.html

                                    Yahoo! Groups Links

                                    To visit your group on the web, go to:

                                    To unsubscribe from this group, send an email to:

                                    Your use of Yahoo! Groups is subject to the Yahoo! Terms of Service.

                                    Do you Yahoo!?
                                    Yahoo! Finance: Get your refund fast by filing online

                                    [Non-text portions of this message have been removed]
                                  • Hans Ginzel
                                    ... Perl won the Linux Journal Editors Choice Award :-) http://www.linuxjournal.com/article.php?sid=6868 VIM is the Favorite Text Editor (Linux Journal
                                    Message 17 of 19 , Feb 5, 2004
                                      On Wed, Feb 04, 2004 at 11:00:04AM -0600, Maria K Meyers wrote:
                                      > >Doesn't Mac OSX come with vi? What could be better?
                                      > Vi is the best editor in the world.

                                      Perl won the Linux Journal Editors' Choice Award :-)

                                      VIM is the Favorite Text Editor
                                      (Linux Journal Readers' Choice Awards) :-)


                                      PS: Wish for next version of perl:
                                      /--v(?-ersion)/ would be a shorthand for
                                    • merlyn@stonehenge.com
                                      ... Hans VIM is the Favorite Text Editor Hans (Linux Journal Readers Choice Awards) :-) Hans http://www.linuxjournal.com/article.php?sid=7029 ooh, this is
                                      Message 18 of 19 , Feb 5, 2004
                                        >>>>> "Hans" == Hans Ginzel <hans@...> writes:

                                        Hans> VIM is the Favorite Text Editor
                                        Hans> (Linux Journal Readers' Choice Awards) :-)
                                        Hans> http://www.linuxjournal.com/article.php?sid=7029

                                        ooh, this is so obviously biased! I demand a florida-style recount!
                                        Over and over. In fact, I can program my Emacs operating system
                                        to send email until it gets changed!

                                        Randal L. Schwartz - Stonehenge Consulting Services, Inc. - +1 503 777 0095
                                        <merlyn@...> <URL:http://www.stonehenge.com/merlyn/>
                                        Perl/Unix/security consulting, Technical writing, Comedy, etc. etc.
                                        See PerlTraining.Stonehenge.com for onsite and open-enrollment Perl training!
                                      • Jeff 'japhy' Pinyan
                                        ... Have you let the Perl Porters know? Sadly, you can t use (?-...), because (?-...) is reserved for turning off regex flags (so (?-i) turns off
                                        Message 19 of 19 , Feb 5, 2004
                                          On Feb 5, Hans Ginzel said:

                                          >PS: Wish for next version of perl:
                                          >/--v(?-ersion)/ would be a shorthand for

                                          Have you let the Perl Porters know? Sadly, you can't use (?-...), because
                                          (?-...) is reserved for turning off regex flags (so (?-i) turns off

                                          However, (??ersion) seems appropriate to me, even if it looks a little
                                          noisy. I could add support for it in Regexp::Parser when I finish it.

                                          Jeff "japhy" Pinyan japhy@... http://www.pobox.com/~japhy/
                                          RPI Acacia brother #734 http://www.perlmonks.org/ http://www.cpan.org/
                                          <stu> what does y/// stand for? <tenderpuss> why, yansliterate of course.
                                          [ I'm looking for programming work. If you like my work, let me know. ]
                                        Your message has been successfully submitted and would be delivered to recipients shortly.