Loading ...
Sorry, an error occurred while loading the content.

Mac OS X terminal question

Expand Messages
  • wadunn83
    First: thanks again for all the help in picking a book. Now: I bought Tisdall s Beg Perl for Bioinformatics. I am trying to type and run a SIMPLE example in
    Message 1 of 1 , Feb 3, 2004
    • 0 Attachment
      First: thanks again for all the help in picking a book.

      Now: I bought Tisdall's Beg Perl for Bioinformatics. I am trying to
      type and run a SIMPLE example in my Mac OS 10.2.x Unix terminal and I
      am completely failing. Can a fellow Mac Perl-er help me out with the
      logistics of where to write the code, where to save it, and how to
      tell my computer to run it. I KNOW THIS IS BELOW you all, but I am
      about to shatter my poor computer screen. I am getting the coding
      ideas I just cant figure out the system. Thank you all for your
      patience. Also, can a Mac person suggest a good free text editor to
      use in writing the code.


      -Augustine

      FYI the code is:

      #!/usr/bin/perl -w
      $DNA = 'AACGGTATGACTGAACGCGGTAGC';

      PRINT DNA;

      EXIT;
    Your message has been successfully submitted and would be delivered to recipients shortly.