Loading ...
Sorry, an error occurred while loading the content.

Testing new Z snps

Expand Messages
  • Patrickt
    I m doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148- I have reviewed the results information on
    Message 1 of 23 , Feb 4, 2012
      I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-

      I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.

      On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.

      Here are my allele mismatches with the U106 haplotype model:

      Allele| U106 Model| Me
      389 13,29 14,30
      447 24 26
      448 19 20
      449 29 30
      464 15,15,17,17 15,15,16,17
      456 16 17
      576 17 18
      413 23,23 23,25
      534 15 16
      520 20 21
      572 11 10
    • Michael Maddi
      Looking at your ySTR results (kit N30554), I d say there s a good chance that you re Z8+. That s based on your values for the following markers, which are very
      Message 2 of 23 , Feb 4, 2012
        Looking at your ySTR results (kit N30554), I'd say there's a good chance that you're Z8+. That's based on your values for the following markers, which are very common in Z8:


        If you test Z8+, as I expect you will, you then might consider ordering Z1, which is a fairly common subclade of Z8. If negative for Z1, then the next step would be to order Z11, which seems to be a smaller subclade of Z8.

        You can order any Z SNP from the Advanced Orders menu, through your FTDNA account. Make sure you choose "SNP" from the pulldown menu in Advanced Orders and then search for the SNP you want to order.

        Mike Maddi
        R1b-U106 Project Co-Administrator

        P.S. It's much better to use SNP results than STR results to investigate deep ancestry. In general, U106 is a northern European subclade, with low levels in southern Europe. If you are Z8+, that would place you even more firmly in northern Europe. We need more testing, which will happen sometime this year when the Z SNPs are added to the deep clade test, but based on present testing, Z8 is found at high levels in the British Isles and the Netherlands. There are some Z8+ members with non-British Isles ancestry (including one with Sicilian ancestry) and some Z8- members with British Isles ancestry. However, when I look at the list of Z8- members, I see significant numbers with non-British Isles ancestry, including Scandinavian and eastern or southern European ancestry.

        From: Patrickt <patricktwall@...>
        To: R1b1c_U106-S21@yahoogroups.com
        Sent: Saturday, February 4, 2012 12:44 PM
        Subject: [R1b1c_U106-S21] Testing new Z snps

        I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-

        I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.

        On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.

        Here are my allele mismatches with the U106 haplotype model:

        Allele| U106 Model| Me
        389 13,29 14,30
        447 24 26
        448 19 20
        449 29 30
        464 15,15,17,17 15,15,16,17
        456 16 17
        576 17 18
        413 23,23 23,25
        534 15 16
        520 20 21
        572 11 10

      • Raymond Wing
        Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.
        Message 3 of 23 , Feb 4, 2012
          Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.

          According to your query (and your ySearch account) you do not share all of the Z8 key STR values. It appears instead you have several key STR values for Z9 which includes 447=26 and 449=30 as well as 534=16. There are a couple of key Z9 markers you don't have (391=10 and 442=11) but it is very rare for a person to have all of these off-modal markers. You really should test for Z9, and I would be very surprised if you came out Z9-. I am less certain whether you would test positive for any of the clades downstream of Z9, but if I were a betting man, I would venture to say you would probably test negative for Z7

          PS:  See http://www.box.com/s/sp3at0c6rnov4r1rz79x for a spreadsheet of haplotypes which have tested these various Z-series SNPs

          From: Patrickt <patricktwall@...>
          To: R1b1c_U106-S21@yahoogroups.com
          Sent: Saturday, February 4, 2012 1:44 PM
          Subject: [R1b1c_U106-S21] Testing new Z snps

          I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-

          I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.

          On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.

          Here are my allele mismatches with the U106 haplotype model:

          Allele| U106 Model| Me
          389 13,29 14,30
          447 24 26
          448 19 20
          449 29 30
          464 15,15,17,17 15,15,16,17
          456 16 17
          576 17 18
          413 23,23 23,25
          534 15 16
          520 20 21
          572 11 10

        • Patrickt
          Thanks Mike, but my kit# is 21541. For the markers you mentioned, I am 447=26, 464=15,15,16,17, H4=11
          Message 4 of 23 , Feb 4, 2012
            Thanks Mike, but my kit# is 21541.

            For the markers you mentioned, I am 447=26, 464=15,15,16,17, H4=11

            --- In R1b1c_U106-S21@yahoogroups.com, Michael Maddi <mtmaddi@...> wrote:
            > Looking at your ySTR results (kit N30554), I'd say there's a good chance that you're Z8+. That's based on your values for the following markers, which are very common in Z8:
            > DYS447=24
            > DYS464a-d=15-16-17-18
            > H4=10
            > If you test Z8+, as I expect you will, you then might consider ordering Z1, which is a fairly common subclade of Z8. If negative for Z1, then the next step would be to order Z11, which seems to be a smaller subclade of Z8.
            > You can order any Z SNP from the Advanced Orders menu, through your FTDNA account. Make sure you choose "SNP" from the pulldown menu in Advanced Orders and then search for the SNP you want to order.
            > Mike Maddi
            > R1b-U106 Project Co-Administrator
            > P.S. It's much better to use SNP results than STR results to investigate deep ancestry. In general, U106 is a northern European subclade, with low levels in southern Europe. If you are Z8+, that would place you even more firmly in northern Europe. We need more testing, which will happen sometime this year when the Z SNPs are added to the deep clade test, but based on present testing, Z8 is found at high levels in the British Isles and the Netherlands. There are some Z8+ members with non-British Isles ancestry (including one with Sicilian ancestry) and some Z8- members with British Isles ancestry. However, when I look at the list of Z8- members, I see significant numbers with non-British Isles ancestry, including Scandinavian and eastern or southern European ancestry.
            > ________________________________
            > From: Patrickt <patricktwall@...>
            > To: R1b1c_U106-S21@yahoogroups.com
            > Sent: Saturday, February 4, 2012 12:44 PM
            > Subject: [R1b1c_U106-S21] Testing new Z snps
            > I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-
            > I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.
            > On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.
            > Here are my allele mismatches with the U106 haplotype model:
            > Allele| U106 Model| Me
            > 389 13,29 14,30
            > 447 24 26
            > 448 19 20
            > 449 29 30
            > 464 15,15,17,17 15,15,16,17
            > 456 16 17
            > 576 17 18
            > 413 23,23 23,25
            > 534 15 16
            > 520 20 21
            > 572 11 10
          • Michael Maddi
            Raymond, Thanks for catching my error. I looked at the original poster s e-mail address and, based on that, was looking at the wrong member s results. You are
            Message 5 of 23 , Feb 4, 2012

              Thanks for catching my error. I looked at the original poster's e-mail address and, based on that, was looking at the wrong member's results.

              You are correct about the STR values of the poster. Based on the correct values, there's a good chance he's Z8-. He should probably start with testing Z9, as you propose.


              From: Raymond Wing <wing_genealogist@...>
              To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
              Sent: Saturday, February 4, 2012 2:38 PM
              Subject: Re: [R1b1c_U106-S21] Testing new Z snps

              Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.

              According to your query (and your ySearch account) you do not share all of the Z8 key STR values. It appears instead you have several key STR values for Z9 which includes 447=26 and 449=30 as well as 534=16. There are a couple of key Z9 markers you don't have (391=10 and 442=11) but it is very rare for a person to have all of these off-modal markers. You really should test for Z9, and I would be very surprised if you came out Z9-. I am less certain whether you would test positive for any of the clades downstream of Z9, but if I were a betting man, I would venture to say you would probably test negative for Z7

              PS:  See http://www.box.com/s/sp3at0c6rnov4r1rz79x for a spreadsheet of haplotypes which have tested these various Z-series SNPs

              From: Patrickt <patricktwall@...>
              To: R1b1c_U106-S21@yahoogroups.com
              Sent: Saturday, February 4, 2012 1:44 PM
              Subject: [R1b1c_U106-S21] Testing new Z snps

              I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-

              I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.

              On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.

              Here are my allele mismatches with the U106 haplotype model:

              Allele| U106 Model| Me
              389 13,29 14,30
              447 24 26
              448 19 20
              449 29 30
              464 15,15,17,17 15,15,16,17
              456 16 17
              576 17 18
              413 23,23 23,25
              534 15 16
              520 20 21
              572 11 10

            • JOHN HARRIS
              Hello Mike, Looking at Clinton Platt s- 03 Feb 2012 (Revision 2.) Haplo Tree top line after R-U106 R-L6, R-L217.1, R-Z18, 19, R-Z381, R-L199 and R-L5. I am
              Message 6 of 23 , Feb 4, 2012
                Hello Mike,

                Looking at Clinton Platt's- 03 Feb 2012 (Revision 2.) Haplo Tree top line after R-U106

                R-L6, R-L217.1, R-Z18, 19, R-Z381, R-L199 and R-L5.

                I am negative for L6, L217, Z18, Z381,

                This leaves  L199 and L5

                Would it be plausible that I might follow one of these lines?

                Kind regards

                John Harris

                From: Michael Maddi <mtmaddi@...>
                To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                Sent: Saturday, 4 February 2012, 20:49
                Subject: Re: [R1b1c_U106-S21] Testing new Z snps


                Thanks for catching my error. I looked at the original poster's e-mail address and, based on that, was looking at the wrong member's results.

                You are correct about the STR values of the poster. Based on the correct values, there's a good chance he's Z8-. He should probably start with testing Z9, as you propose.


                From: Raymond Wing <wing_genealogist@...>
                To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                Sent: Saturday, February 4, 2012 2:38 PM
                Subject: Re: [R1b1c_U106-S21] Testing new Z snps

                Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.

                According to your query (and your ySearch account) you do not share all of the Z8 key STR values. It appears instead you have several key STR values for Z9 which includes 447=26 and 449=30 as well as 534=16. There are a couple of key Z9 markers you don't have (391=10 and 442=11) but it is very rare for a person to have all of these off-modal markers. You really should test for Z9, and I would be very surprised if you came out Z9-. I am less certain whether you would test positive for any of the clades downstream of Z9, but if I were a betting man, I would venture to say you would probably test negative for Z7

                PS:  See http://www.box.com/s/sp3at0c6rnov4r1rz79x for a spreadsheet of haplotypes which have tested these various Z-series SNPs

                From: Patrickt <patricktwall@...>
                To: R1b1c_U106-S21@yahoogroups.com
                Sent: Saturday, February 4, 2012 1:44 PM
                Subject: [R1b1c_U106-S21] Testing new Z snps

                I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-

                I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.

                On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.

                Here are my allele mismatches with the U106 haplotype model:

                Allele| U106 Model| Me
                389 13,29 14,30
                447 24 26
                448 19 20
                449 29 30
                464 15,15,17,17 15,15,16,17
                456 16 17
                576 17 18
                413 23,23 23,25
                534 15 16
                520 20 21
                572 11 10

              • Patrickt
                Fantastic! Thanks for the tips!
                Message 7 of 23 , Feb 4, 2012
                  Fantastic! Thanks for the tips!

                  --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                  > Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.
                  > According to your query (and your ySearch account) you do not share all of the Z8 key STR values. It appears instead you have several key STR values for Z9 which includes 447=26 and 449=30 as well as 534=16. There are a couple of key Z9 markers you don't have (391=10 and 442=11) but it is very rare for a person to have all of these off-modal markers. You really should test for Z9, and I would be very surprised if you came out Z9-. I am less certain whether you would test positive for any of the clades downstream of Z9, but if I were a betting man, I would venture to say you would probably test negative for Z7
                  > Ray
                  > PS:  See http://www.box.com/s/sp3at0c6rnov4r1rz79x for a spreadsheet of haplotypes which have tested these various Z-series SNPs
                  > ________________________________
                  > From: Patrickt <patricktwall@...>
                  > To: R1b1c_U106-S21@yahoogroups.com
                  > Sent: Saturday, February 4, 2012 1:44 PM
                  > Subject: [R1b1c_U106-S21] Testing new Z snps
                  > I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-
                  > I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.
                  > On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.
                  > Here are my allele mismatches with the U106 haplotype model:
                  > Allele| U106 Model| Me
                  > 389 13,29 14,30
                  > 447 24 26
                  > 448 19 20
                  > 449 29 30
                  > 464 15,15,17,17 15,15,16,17
                  > 456 16 17
                  > 576 17 18
                  > 413 23,23 23,25
                  > 534 15 16
                  > 520 20 21
                  > 572 11 10
                • John German
                  Aside from the obvious answer that the primers are not ready, is there any news about Z304-Z306? Any sense about when or ever they will become available for
                  Message 8 of 23 , Feb 4, 2012
                    Aside from the obvious answer that the primers are not ready, is there
                    any news about Z304-Z306? Any sense about when or ever they will become
                    available for public purchase?
                  • Vince
                    I had sent primer design candidates for Z305 and Z306 to Thomas Krahn on September 9, 2011. I have no idea as to when FTDNA plans on doing something about
                    Message 9 of 23 , Feb 5, 2012
                      I had sent primer design candidates for Z305 and Z306 to Thomas Krahn on September 9, 2011. I have no idea as to when FTDNA plans on doing something about them, only that Bennett Greenspan had promised to make them available, eventually.

                      Vince Tilroe

                      --- In R1b1c_U106-S21@yahoogroups.com, John German <german@...> wrote:
                      > Aside from the obvious answer that the primers are not ready, is there
                      > any news about Z304-Z306? Any sense about when or ever they will become
                      > available for public purchase?
                    • Raymond Wing
                      Thomas Krahn s Y Chromosome browser (http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/) still does not show the primers for Z305 & Z306.   I m sure Thomas
                      Message 10 of 23 , Feb 5, 2012
                        Thomas Krahn's Y Chromosome browser (http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/) still does not show the primers for Z305 & Z306.  

                        I'm sure Thomas (and FT-DNA) are quite busy with a number of "pots in the fire", but as Vince said, they should be available sometime down the road.  The best advice I can give at this point in time is patience.

                        From: Vince <vince@...>
                        To: R1b1c_U106-S21@yahoogroups.com
                        Sent: Sunday, February 5, 2012 2:48 PM
                        Subject: [R1b1c_U106-S21] Re: Testing new Z snps

                        I had sent primer design candidates for Z305 and Z306 to Thomas Krahn on September 9, 2011. I have no idea as to when FTDNA plans on doing something about them, only that Bennett Greenspan had promised to make them available, eventually.

                        Vince Tilroe

                        --- In R1b1c_U106-S21@yahoogroups.com, John German <german@...> wrote:
                        > Aside from the obvious answer that the primers are not ready, is there
                        > any news about Z304-Z306? Any sense about when or ever they will become
                        > available for public purchase?

                      • Vince
                        If someone wants these bad enough to pass these on to another lab in the mean time, (Scotlands DNA perhaps?) the primers are: Z305_F AAAGTAGAAAGGTTGCCATTTG,
                        Message 11 of 23 , Feb 5, 2012
                          If someone wants these bad enough to pass these on to another lab in the mean time, (Scotlands DNA perhaps?) the primers are:

                          Z305_F AAAGTAGAAAGGTTGCCATTTG, Z305_R TTTTGAATTGGAAACTATGATGC (amplifies NCBI36 ChrY:21014180..21014779)

                          Z306_F ATGTTCCCTTGGTCTCTGTG, Z306_R CAGCAACCAAAGCAAAGATG (amplifies NCBI36 ChrY:21196963..21197560)

                          Both sets were found using Finch2/Primer3 with FTDNA's standard default parameters.

                          There were a bunch more in the primer list sent to Thomas Krahn in the 9 Sept 2011 email -- most were found using FTDNA's defaults, others were found with a bit of tweaking, and checked against an online electronic PCR simulator (http://genome.ucsc.edu/cgi-bin/hgPcr?command=start):

                          Z83 (alternate set included Z83 and Z262)
                          Z333 (alternate set included Z333 and S3)
                          Z334 (alternate set included Z334 and Z276)

                          It doesn't appear that FTDNA has made progress with any of them as yet.

                          Vince Tilroe

                          --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                          > Thomas Krahn's Y Chromosome browser (http://ymap.ftdna.com/cgi-bin/gb2/gbrowse/hs_chrY/) still does not show the primers for Z305 & Z306.
                          > I'm sure Thomas (and FT-DNA) are quite busy with a number of "pots in the fire", but as Vince said, they should be available sometime down the road.  The best advice I can give at this point in time is patience.
                          > Ray
                          > ________________________________
                          > From: Vince <vince@...>
                          > To: R1b1c_U106-S21@yahoogroups.com
                          > Sent: Sunday, February 5, 2012 2:48 PM
                          > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                          > I had sent primer design candidates for Z305 and Z306 to Thomas Krahn on September 9, 2011. I have no idea as to when FTDNA plans on doing something about them, only that Bennett Greenspan had promised to make them available, eventually.
                          > Vince Tilroe
                          > --- In R1b1c_U106-S21@yahoogroups.com, John German <german@> wrote:
                          > >
                          > > Aside from the obvious answer that the primers are not ready, is there
                          > > any news about Z304-Z306? Any sense about when or ever they will become
                          > > available for public purchase?
                          > >
                        • gubbins@talk21.com
                          Vince - thanks for the update. I know a few of us are waiting on them. Cheers, Iain.
                          Message 12 of 23 , Feb 6, 2012
                            Vince - thanks for the update. I know a few of us are waiting on them. Cheers,

                          • Patrickt
                            My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? Looking at my closest matches on ysearch, their surnames indicate at
                            Message 13 of 23 , Feb 11, 2012
                              My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? Looking at my closest matches on ysearch, their surnames indicate at Brittany-Norman-Flemish origin. They are:

                              Cummings [555SZ] - genetic distance 9
                              Catret (Carteret) [FYANR] – genetic distance 11
                              Ellis [8374A] – genetic distance 12, according to U106 project its 10

                              Doing background research on the surnames, Cummings (from Comines) is most likely Norman or Flemish. Some researchers have looked at the coat of arms of the leader of the Cummings clan from the 13th century and they match the arms of the Campdevene family, which come out of Flanders. Also Comines is on the border of France and Belgium in the area that was owned by the Campdevene family. Another interesting piece of information is 555SZ has a genetic distance of 1 match with the surname Pierce. They have only tested 25 markers, so it may not mean much, but Pierce is a Norman surname. Also, if it was a line that changed from Percy to Pierce, then that paternal line goes back to Joseline de Louvain, who was a male descendant from the House of Flanders like the Campdevene line. Two different male lines of descent from the same family.

                              Carteret is a very well known Norman surname, the family being the Lords of the Isle of Jersey off the Normandy coast. They originally were from Barnville-Carteret on the Norman Coast across from Jersey.

                              Ellis can be a Breton, Norman or even a Jewish surname.

                              Thoughts on possible subclades under Z9? I've notice discussions about Z2 and Norman ancestry.

                              --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                              > Looking over your ySearch account (from your DNA-Forums query), it appears Mike Maddi erred when he tried to find you in the U106/S21 Project database.
                              > According to your query (and your ySearch account) you do not share all of the Z8 key STR values. It appears instead you have several key STR values for Z9 which includes 447=26 and 449=30 as well as 534=16. There are a couple of key Z9 markers you don't have (391=10 and 442=11) but it is very rare for a person to have all of these off-modal markers. You really should test for Z9, and I would be very surprised if you came out Z9-. I am less certain whether you would test positive for any of the clades downstream of Z9, but if I were a betting man, I would venture to say you would probably test negative for Z7
                              > Ray
                              > PS:  See http://www.box.com/s/sp3at0c6rnov4r1rz79x for a spreadsheet of haplotypes which have tested these various Z-series SNPs
                              > ________________________________
                              > From: Patrickt <patricktwall@...>
                              > To: R1b1c_U106-S21@yahoogroups.com
                              > Sent: Saturday, February 4, 2012 1:44 PM
                              > Subject: [R1b1c_U106-S21] Testing new Z snps
                              > I'm doing research on my L48 Y-DNA results. I did SNP testing in August 2011 and I tested L48+ L47- L44- L188- L148-
                              > I have reviewed the results information on the U106 project page and a couple questions were raised. Looking at the individual allele comparisons on the markers that my DNA differs from the U106 model have the highest percentages in North East, South East and South West Europe. Does that mean my Y-DNA is from the eastern part of Europe or possibly southern Europe? My paternal line goes back to Charleston county in South Carolina where there were people for all over Europe, not just from the British Isles, France, and Germany. So, having paternal ancestry from eastern or southern Europe is not out of the question. In fact, there was a family of Polish descent living near my family with the surname of Hrabowski. They originated from Slovenia. Their DNA signature is different from mine, but they do have similar numbers on the alleles that I mismatched the U106 model.
                              > On the U106 analysis, the closest surname I match is Ellis with GD of 10, placing common ancestor around 1800 years ago. That line is from Wales. Also Ellis could have come from a Jewish person taking as a surname of Elias/Elijah. Anyway, if there is someone who is expert at looking at alleles to determine a general region of origin would be greatly appreciated. Trying to figure out which advanced testing I should take.
                              > Here are my allele mismatches with the U106 haplotype model:
                              > Allele| U106 Model| Me
                              > 389 13,29 14,30
                              > 447 24 26
                              > 448 19 20
                              > 449 29 30
                              > 464 15,15,17,17 15,15,16,17
                              > 456 16 17
                              > 576 17 18
                              > 413 23,23 23,25
                              > 534 15 16
                              > 520 20 21
                              > 572 11 10
                            • Raymond Wing
                              Patrick, It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is
                              Message 14 of 23 , Feb 12, 2012

                                It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.

                                If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).

                                From: Patrickt <patricktwall@...>
                                To: R1b1c_U106-S21@yahoogroups.com
                                Sent: Saturday, February 11, 2012 2:47 PM
                                Subject: [R1b1c_U106-S21] Re: Testing new Z snps

                                My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                              • Raymond Wing
                                I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site.  There are two other known subclades of L48+,
                                Message 15 of 23 , Feb 12, 2012
                                  I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 

                                  There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  

                                  While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.

                                  From: Raymond Wing <wing_genealogist@...>
                                  To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                  Sent: Sunday, February 12, 2012 7:52 AM
                                  Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps


                                  It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.

                                  If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).

                                  From: Patrickt <patricktwall@...>
                                  To: R1b1c_U106-S21@yahoogroups.com
                                  Sent: Saturday, February 11, 2012 2:47 PM
                                  Subject: [R1b1c_U106-S21] Re: Testing new Z snps

                                  My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                • Van
                                  According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with
                                  Message 16 of 23 , Feb 13, 2012
                                    According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with EA and has since been removed by them. I did some checking on Y-Search and the closest match to Lewis is a generic results put together from the Wales_Cyrmu DNA Project. I check the results from that site and there were several who came very close to me and Lewis especially someone with kit number 148478. It might be worthwhile to check on that kit.


                                    --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                                    > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                    > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                    > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                    > Ray
                                    > From: Raymond Wing <wing_genealogist@...>
                                    > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                    > Sent: Sunday, February 12, 2012 7:52 AM
                                    > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                    > Patrick,
                                    > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                    > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                    > Ray
                                    > ________________________________
                                    > From: Patrickt <patricktwall@...>
                                    > To: R1b1c_U106-S21@yahoogroups.com
                                    > Sent: Saturday, February 11, 2012 2:47 PM
                                    > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                    > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                  • Patrickt
                                    Message 17 of 23 , Feb 13, 2012

                                      --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                                      > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                      > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                      > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                      > Ray
                                      > From: Raymond Wing <wing_genealogist@...>
                                      > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                      > Sent: Sunday, February 12, 2012 7:52 AM
                                      > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                      > Patrick,
                                      > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                      > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                      > Ray
                                      > ________________________________
                                      > From: Patrickt <patricktwall@...>
                                      > To: R1b1c_U106-S21@yahoogroups.com
                                      > Sent: Saturday, February 11, 2012 2:47 PM
                                      > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                      > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                    • connofthe100battles
                                      S69 was never a regular offering at EA. I asked them if they would test me for it and they did, I was negative. Contact them and ask them if they will test
                                      Message 18 of 23 , Feb 14, 2012
                                        S69 was never a regular offering at EA. I asked them if they would test me for it and they did, I was negative. Contact them and ask them if they will test it for you. It can't hurt.


                                        --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@...> wrote:
                                        > According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with EA and has since been removed by them. I did some checking on Y-Search and the closest match to Lewis is a generic results put together from the Wales_Cyrmu DNA Project. I check the results from that site and there were several who came very close to me and Lewis especially someone with kit number 148478. It might be worthwhile to check on that kit.
                                        > Van
                                        > --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@> wrote:
                                        > >
                                        > > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                        > >
                                        > > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                        > >
                                        > > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                        > >  
                                        > > Ray
                                        > >
                                        > > From: Raymond Wing <wing_genealogist@>
                                        > > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                        > > Sent: Sunday, February 12, 2012 7:52 AM
                                        > > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                        > >
                                        > >
                                        > >  
                                        > > Patrick,
                                        > >
                                        > > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                        > >
                                        > > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                        > >  
                                        > > Ray
                                        > >
                                        > >
                                        > > ________________________________
                                        > > From: Patrickt <patricktwall@>
                                        > > To: R1b1c_U106-S21@yahoogroups.com
                                        > > Sent: Saturday, February 11, 2012 2:47 PM
                                        > > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                        > >
                                        > >
                                        > >  
                                        > > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                        > >
                                      • Van
                                        I went to their web site and found out EthnoAncestry has been taken over by a new company BritishDNA and their web site is shown as www.scotlandsDNA.com. Van
                                        Message 19 of 23 , Feb 15, 2012
                                          I went to their web site and found out EthnoAncestry has been taken over by a new company BritishDNA and their web site is shown as www.scotlandsDNA.com.


                                          --- In R1b1c_U106-S21@yahoogroups.com, "connofthe100battles" <dolls@...> wrote:
                                          > S69 was never a regular offering at EA. I asked them if they would test me for it and they did, I was negative. Contact them and ask them if they will test it for you. It can't hurt.
                                          > Chris
                                          > --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@> wrote:
                                          > >
                                          > > According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with EA and has since been removed by them. I did some checking on Y-Search and the closest match to Lewis is a generic results put together from the Wales_Cyrmu DNA Project. I check the results from that site and there were several who came very close to me and Lewis especially someone with kit number 148478. It might be worthwhile to check on that kit.
                                          > >
                                          > > Van
                                          > >
                                          > > --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@> wrote:
                                          > > >
                                          > > > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                          > > >
                                          > > > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                          > > >
                                          > > > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                          > > >  
                                          > > > Ray
                                          > > >
                                          > > > From: Raymond Wing <wing_genealogist@>
                                          > > > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                          > > > Sent: Sunday, February 12, 2012 7:52 AM
                                          > > > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                          > > >
                                          > > >
                                          > > >  
                                          > > > Patrick,
                                          > > >
                                          > > > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                          > > >
                                          > > > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                          > > >  
                                          > > > Ray
                                          > > >
                                          > > >
                                          > > > ________________________________
                                          > > > From: Patrickt <patricktwall@>
                                          > > > To: R1b1c_U106-S21@yahoogroups.com
                                          > > > Sent: Saturday, February 11, 2012 2:47 PM
                                          > > > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                          > > >
                                          > > >
                                          > > >  
                                          > > > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                          > > >
                                          > >
                                        • Van
                                          I have been conducting some searching for information on the Lewis (Y-Search DYYG8) that the 111-Sandbox is shown as a possibility connection to me. He was
                                          Message 20 of 23 , Feb 15, 2012
                                            I have been conducting some searching for information on the Lewis (Y-Search DYYG8) that the 111-Sandbox is shown as a possibility connection to me. He was originally found to have the S69 from EthnoAncestry but not much was known of his test results. I found information on Lewis on the Semargl.me site (www.semargl.me/en/dna/) which shows him as not only Y-Search DYYG8 but he has tested with Family Tree DNA and is on the Lewis Project (www.familytreedna.com/public/LEWISSurnameDNAProject/) with kit number 49174. I checked both Y-Search and the Lewis site and the same ancestors is listed on both so I know this is the same person. On the Lewis site his list of SNP's show that he is U106 negative, so he must be P312 and so will not be of any connection to me, thus making my L693 more of a private SNP.


                                            --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@...> wrote:
                                            > I went to their web site and found out EthnoAncestry has been taken over by a new company BritishDNA and their web site is shown as www.scotlandsDNA.com.
                                            > Van
                                            > --- In R1b1c_U106-S21@yahoogroups.com, "connofthe100battles" <dolls@> wrote:
                                            > >
                                            > > S69 was never a regular offering at EA. I asked them if they would test me for it and they did, I was negative. Contact them and ask them if they will test it for you. It can't hurt.
                                            > >
                                            > > Chris
                                            > >
                                            > > --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@> wrote:
                                            > > >
                                            > > > According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with EA and has since been removed by them. I did some checking on Y-Search and the closest match to Lewis is a generic results put together from the Wales_Cyrmu DNA Project. I check the results from that site and there were several who came very close to me and Lewis especially someone with kit number 148478. It might be worthwhile to check on that kit.
                                            > > >
                                            > > > Van
                                            > > >
                                            > > > --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@> wrote:
                                            > > > >
                                            > > > > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                            > > > >
                                            > > > > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                            > > > >
                                            > > > > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                            > > > >  
                                            > > > > Ray
                                            > > > >
                                            > > > > From: Raymond Wing <wing_genealogist@>
                                            > > > > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                            > > > > Sent: Sunday, February 12, 2012 7:52 AM
                                            > > > > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                            > > > >
                                            > > > >
                                            > > > >  
                                            > > > > Patrick,
                                            > > > >
                                            > > > > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                            > > > >
                                            > > > > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                            > > > >  
                                            > > > > Ray
                                            > > > >
                                            > > > >
                                            > > > > ________________________________
                                            > > > > From: Patrickt <patricktwall@>
                                            > > > > To: R1b1c_U106-S21@yahoogroups.com
                                            > > > > Sent: Saturday, February 11, 2012 2:47 PM
                                            > > > > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                            > > > >
                                            > > > >
                                            > > > >  
                                            > > > > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                            > > > >
                                            > > >
                                            > >
                                          • Patrickt
                                            Ray, I guess you can add me to the list as the results came back today and I am indeed Z9+.
                                            Message 21 of 23 , Feb 16, 2012

                                              I guess you can add me to the list as the results came back today and I am indeed Z9+.

                                              --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@...> wrote:
                                              > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                              > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                              > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                              > Ray
                                              > From: Raymond Wing <wing_genealogist@...>
                                              > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                              > Sent: Sunday, February 12, 2012 7:52 AM
                                              > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                              > Patrick,
                                              > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                              > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                              > Ray
                                              > ________________________________
                                              > From: Patrickt <patricktwall@...>
                                              > To: R1b1c_U106-S21@yahoogroups.com
                                              > Sent: Saturday, February 11, 2012 2:47 PM
                                              > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                              > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                            • Charles
                                              Attention Clinton Platt! Good work Van! John McEwan added the former EthnoAncestry private SNP S69 to the ISOGG R page on 5 Dec 2006. 12 days later on 17 Dec,
                                              Message 22 of 23 , Feb 16, 2012
                                                Attention Clinton Platt!

                                                Good work Van!

                                                John McEwan added the former EthnoAncestry private SNP S69 to the ISOGG R page on 5 Dec 2006. 12 days later on 17 Dec, he added U106 as a SNP at then Haplogroup level R1b1c9. The End of Year 2006 R page shows S69 as a private SNP under then R1b1c9 (R-U106).

                                                Based on Van's work, this was evidently an error that has remained with us ever since.

                                                Although the Lewis STRs are similar to Van's, there is a very notable exception, which is the Lewis result 492=12. As we know, there is an extremely high correlation in R-U106 to the increase to 492=13, which Lewis doesn't have. He is shown on the Lewis project as M269+, but U106-. Consequently, all that we really know is that S69 lies below R-M269, but not at the R-U106 level or below.

                                                Clinton, at your convenience, you will want to remove the note about S69 from your nifty R-U106 tree.


                                                --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@...> wrote:
                                                > I have been conducting some searching for information on the Lewis (Y-Search DYYG8) that the 111-Sandbox is shown as a possibility connection to me. He was originally found to have the S69 from EthnoAncestry but not much was known of his test results. I found information on Lewis on the Semargl.me site (www.semargl.me/en/dna/) which shows him as not only Y-Search DYYG8 but he has tested with Family Tree DNA and is on the Lewis Project (www.familytreedna.com/public/LEWISSurnameDNAProject/) with kit number 49174. I checked both Y-Search and the Lewis site and the same ancestors is listed on both so I know this is the same person. On the Lewis site his list of SNP's show that he is U106 negative, so he must be P312 and so will not be of any connection to me, thus making my L693 more of a private SNP.
                                                > Van
                                                > --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@> wrote:
                                                > >
                                                > > I went to their web site and found out EthnoAncestry has been taken over by a new company BritishDNA and their web site is shown as www.scotlandsDNA.com.
                                                > >
                                                > > Van
                                                > >
                                                > > --- In R1b1c_U106-S21@yahoogroups.com, "connofthe100battles" <dolls@> wrote:
                                                > > >
                                                > > > S69 was never a regular offering at EA. I asked them if they would test me for it and they did, I was negative. Contact them and ask them if they will test it for you. It can't hurt.
                                                > > >
                                                > > > Chris
                                                > > >
                                                > > > --- In R1b1c_U106-S21@yahoogroups.com, "Van" <rblackwell1001@> wrote:
                                                > > > >
                                                > > > > According to the 111 haplotype chart the person who has the nearest match to my L693 is a Lewis who was found to have an S69 that I believe was originally with EA and has since been removed by them. I did some checking on Y-Search and the closest match to Lewis is a generic results put together from the Wales_Cyrmu DNA Project. I check the results from that site and there were several who came very close to me and Lewis especially someone with kit number 148478. It might be worthwhile to check on that kit.
                                                > > > >
                                                > > > > Van
                                                > > > >
                                                > > > > --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@> wrote:
                                                > > > > >
                                                > > > > > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                                > > > > >
                                                > > > > > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                                > > > > >
                                                > > > > > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                                > > > > >  
                                                > > > > > Ray
                                                > > > > >
                                                > > > > > From: Raymond Wing <wing_genealogist@>
                                                > > > > > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                                > > > > > Sent: Sunday, February 12, 2012 7:52 AM
                                                > > > > > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                                > > > > >
                                                > > > > >
                                                > > > > >  
                                                > > > > > Patrick,
                                                > > > > >
                                                > > > > > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                                > > > > >
                                                > > > > > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                                > > > > >  
                                                > > > > > Ray
                                                > > > > >
                                                > > > > >
                                                > > > > > ________________________________
                                                > > > > > From: Patrickt <patricktwall@>
                                                > > > > > To: R1b1c_U106-S21@yahoogroups.com
                                                > > > > > Sent: Saturday, February 11, 2012 2:47 PM
                                                > > > > > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                                > > > > >
                                                > > > > >
                                                > > > > >  
                                                > > > > > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                                > > > > >
                                                > > > >
                                                > > >
                                                > >
                                              • Patrickt
                                                And Z2 negative.
                                                Message 23 of 23 , Mar 1, 2012
                                                  And Z2 negative.

                                                  --- In R1b1c_U106-S21@yahoogroups.com, "Patrickt" <patricktwall@...> wrote:
                                                  > Ray,
                                                  > I guess you can add me to the list as the results came back today and I am indeed Z9+.
                                                  > --- In R1b1c_U106-S21@yahoogroups.com, Raymond Wing <wing_genealogist@> wrote:
                                                  > >
                                                  > > I did quickly check the excellent 111 haplotype chart Charles Moore posted in the files section of this site. 
                                                  > >
                                                  > > There are two other known subclades of L48+, L47-, Z9-.  They are L200 & L693.  Your STR values do not have the off-modal values found in L200, so it is fairly safe to say you would likely be found L200-. There currently is only one known L693, so it may possibly be a private/family SNP.  
                                                  > >
                                                  > > While it would be your decision whether to test for these SNPs if you come up Z9-, it is likely you would be negative for both. However, I would personally be surprised if you are Z9-, rather than Z9+. As was stated earlier, you do have most of the off-modal values for Z9.
                                                  > >  
                                                  > > Ray
                                                  > >
                                                  > > From: Raymond Wing <wing_genealogist@>
                                                  > > To: "R1b1c_U106-S21@yahoogroups.com" <R1b1c_U106-S21@yahoogroups.com>
                                                  > > Sent: Sunday, February 12, 2012 7:52 AM
                                                  > > Subject: Re: [R1b1c_U106-S21] Re: Testing new Z snps
                                                  > >
                                                  > >
                                                  > >  
                                                  > > Patrick,
                                                  > >
                                                  > > It looks like you will likely remain somewhere near Z9.  If you test positive for it, then the next step would be to test Z2 (which currently is immediately below Z9). If, by some chance you test positive for Z2 (which to me, at the present time, seems unlikely), then test for Z7.
                                                  > >
                                                  > > If you test negative for Z9, then you would fall into the L48* (Z9-, L47-) category. While there are some other possible SNPs, they are quite small (and I have not really studied that part of the tree).
                                                  > >  
                                                  > > Ray
                                                  > >
                                                  > >
                                                  > > ________________________________
                                                  > > From: Patrickt <patricktwall@>
                                                  > > To: R1b1c_U106-S21@yahoogroups.com
                                                  > > Sent: Saturday, February 11, 2012 2:47 PM
                                                  > > Subject: [R1b1c_U106-S21] Re: Testing new Z snps
                                                  > >
                                                  > >
                                                  > >  
                                                  > > My Z9 test is pending with FTDNA. If it comes back positive, which SNP should I test next? ....
                                                  > >
                                                Your message has been successfully submitted and would be delivered to recipients shortly.