Loading ...
Sorry, an error occurred while loading the content.

L1198 / Z 185

Expand Messages
  • Brian McCall
    I am L1198. I tested for  Z185. I was Z185+. I read the Genome 1000 Z185 predictions. I read the recommendstions on the I-M223 group divisions.   I do not
    Message 1 of 14 , Nov 6, 2012
    • 0 Attachment
      I am L1198. I tested for  Z185. I was Z185+. I read the Genome 1000 Z185 predictions.
      I read the recommendstions on the I-M223 group divisions.
       
      I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it.
      Brian
       
    • Wayne Roberts
      Brian McCall wrote: I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it. Brian Brian, that is how I read it also as
      Message 2 of 14 , Nov 6, 2012
      • 0 Attachment
         
        Brian McCall wrote:

        I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it. Brian
         
         
        Brian, that is how I read it also as phylo-equivalent. If one is positive for L1198 then they are positive for Z185 and visa versa. This is why I listed it in my previous email as L1198/Z185. Thanks, Wayne.
      • Brian McCall
        Well, then. You got me to bring it up. It has not been placed phyloequivalent to L1198. It is still a recommended snp, in a Z78 group. Z78 is a big group.
        Message 3 of 14 , Nov 6, 2012
        • 0 Attachment
          Well, then. You got me to bring it up. It has not been placed phyloequivalent to L1198. It is still a recommended snp, in a Z78 group. Z78 is a big group. Since, L1198, Z190 and Z79 has been Z185+. 
          Maybe, it will turn out, to be a good snp. That will place well, in I-M223 tree.
           As L1198 cont 1, I tested Z185. Therefore, we could add information, to the predicted Z185 location.  The bast I remember. It simply appeared pre-L1198.
           I wonder. If anyone knows. How long ago Z185 was discovered- aka: Could it be included on the Geno 2.0 test.
          Brian
           
           

          From: Wayne Roberts <wayne_r_roberts@...>
          To: I-M223@yahoogroups.com
          Sent: Tuesday, November 6, 2012 9:05 PM
          Subject: Re: [I-M223] L1198 / Z 185
           
           
          Brian McCall wrote:

          I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it. Brian
           
           
          Brian, that is how I read it also as phylo-equivalent. If one is positive for L1198 then they are positive for Z185 and visa versa. This is why I listed it in my previous email as L1198/Z185. Thanks, Wayne.
        • Wayne Roberts
          Brain, These may be of interest. Name: Z185 Type: snp Description: Source: other Position: ChrY:21338772..21338772 (+ strand) Length: 1 ISOGG_haplogroup:
          Message 4 of 14 , Nov 7, 2012
          • 0 Attachment
            
            Brain,
             
            These may be of interest.
             
            Name:Z185
            Type:snp
            Description:
            Source:other
            Position:ChrY:21338772..21338772 (+ strand)
            Length:1
            ISOGG_haplogroup:not listed
            Mutation:T to C
            YCC_haplogroup:Approx. hg: I-M223
            allele_anc:T
            allele_der:C
            comments:I-M223
            parallel to M284
            M379
            P78
            P95
            between approx. Z77 and approx. Z78
            count_derived:7
            count_tested:13
            primer_f:Z185v2_F GCTTGGATATGCCTGGCTGG
            primer_r:Z185v2_R GACTGACTAGAGTTGCCAGCTTG
            primary_id:46945
            gbrowse_dbid:ymap:database
             
             
            Name:L1198
            Type:snp
            Description:
            Source:other
            Position:ChrY:16915182..16915182 (+ strand)
            Length:1
            ISOGG_haplogroup:not listed
            Mutation:C to T
            YCC_haplogroup:Approx. hg: I-L801
            allele_anc:C
            allele_der:T
            comments:Found in a hg I-L801 WTY participant
            count_derived:27
            count_tested:128
            primer_f:Z34_F
            primer_r:Z34_R
            primary_id:45534
            gbrowse_dbid:ymap:database
             
             
            Cheers
            Wayne
          • sallfertorr
            Hello, all It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198. Then, we need Z78* members to test
            Message 5 of 14 , Nov 8, 2012
            • 0 Attachment
              Hello, all

              It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.

              Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.

              Thanks,
              Aaron Torres

              --- In I-M223@yahoogroups.com, "Wayne Roberts" <wayne_r_roberts@...> wrote:
              >
              >
              > Brian McCall wrote:
              >
              >
              > I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it. Brian
              >
              >
              >
              > Brian, that is how I read it also as phylo-equivalent. If one is positive for L1198 then they are positive for Z185 and visa versa. This is why I listed it in my previous email as L1198/Z185. Thanks, Wayne.
              >
            • Wayne Roberts
              Thanks for clearing that up Aaron. The novice learns from the master. :-) ... From: sallfertorr To: I-M223@yahoogroups.com Sent: Thursday, November 08, 2012
              Message 6 of 14 , Nov 8, 2012
              • 0 Attachment
                Thanks for clearing that up Aaron.
                 
                The novice learns from the master. :-)
                ----- Original Message -----
                Sent: Thursday, November 08, 2012 10:08 PM
                Subject: [I-M223] Re: L1198 / Z 185

                 

                Hello, all

                It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.

                Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.

                Thanks,
                Aaron Torres

              • Tony Norris
                You re doing a great job Aaron - Wish more of my Z79+ hits would test more! I m working on all with whom I have contact. And my Norris line(a minority of
                Message 7 of 14 , Nov 8, 2012
                • 0 Attachment
                  You're doing a great job Aaron - Wish more of my Z79+ hits would test more! I'm working on all with whom I have contact. And my Norris line(a minority of Norris) apparently has some surname clusters (Hamilton+varients, Lee, Howard, Nesbit) who are within 3-4 STR steps on 67 markers who I wish would start testing SNPs. any help appreciated.
                  Tony
                  I2a2a3a2a1a   M223>Z161>L801>Z78 >L1198/Z185>Z190>Z79 (Cont1c1)
                • Jaco Strauss
                  Hi Aaron As you know I am Z78+ but L1198- and Z79- From the Project I understand that Z78+ also means that I would be M223+ Z161+ L801+ Z76+ Downstream from
                  Message 8 of 14 , Nov 9, 2012
                  • 0 Attachment

                    Hi Aaron

                    As you know I am Z78+ but L1198- and Z79-

                    From the Project I understand that Z78+ also means that I would be 
                    M223+ >Z161+ >L801+ Z76+

                    Downstream from Z78 we seem to have something like:

                    Z78+ > L1198+ >Z185+ > Z171+ > Z79+
                    or 
                    Z78+ > L1198+ > Z171+ >Z185+ > Z79+
                    or
                    Z78+ > Z185+ > Z171+ > L1198+ >Z79+
                    etc...

                    Looking at current results as published by http://www.semargl.me/en/dna/ydna/item-snp/1397/ one can deduce the following:

                    NORRIS      Z78+ > L1198+ >Z185+ > Z171? Z79+
                    HAKULI       Z78+ > L1198+ >Z185? > Z171? Z79+
                    MCCALL     Z78+ > L1198+ >Z185+ > Z171+ Z79-
                    WAALKES  Z78+ > L1198+ >Z185+ > Z171? Z79-
                    GRIJPSTRA Z78+ > L1198+ >Z185? > Z171? Z79-
                    NIELSON     Z78+ > L1198- >Z185- > Z171? Z79-
                    STRAUSS    Z78+ > L1198- >Z185? > Z171? Z79-

                    When looking at this list, it really looks as if Z185 and Z171 could be downstream from L1198. But for that to be confirmed we need NORRIS, HAKULI, GRIJPSTRA or WAALKES to post a negative result for them.

                    In the case of me (STRAUSS) and NIELSON any positive result would place them upstream of L1198 for which we tested negative. 

                    I have recently ordered FF tests for both my parents as well as my wife so held back a little on more SNP testing. If I were to test either Z185 or Z171 first, which would be expected to be the more helpful?

                    Regards

                    -- 
                    Jaco Strauss
                    Cape Town


                    Thu Nov 8, 2012 4:08 am (PST) . Posted by:

                    "sallfertorr" sallfertorr

                    Hello, all

                    It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.

                    Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.

                    Thanks,
                    Aaron Torres
                  • Jaco Strauss
                    Hi Aaron I see Ken Nordtvedt has placed Z185 downstream of L1198. http://knordtvedt.home.bresnan.net/Tree for
                    Message 9 of 14 , Nov 14, 2012
                    • 0 Attachment

                      Hi Aaron

                      I see Ken Nordtvedt has placed Z185 downstream of L1198. http://knordtvedt.home.bresnan.net/Tree for M223+.pdf

                      I am negative for L1198 and have already tested for the downstream Z79. I would really not like to test for some other SNP downstream of one I am already negative for. 

                      Z171 at least has an outside chance of being upstream of L1198. Or do you disagree with Ken's tree?

                      Regards

                      Jaco



                      2012/11/9 Aaron Salles Torres <sallestorres@...>
                      Hello, Jaco

                      No conclusions can be reached about Z185 and Z171 yet. We need more results to know if these SNP's can be helpful breaking down the L1198- community. That is why I am encouraging tests within Z78* individuals (all L1198+ individuals have been positive for these SNP's so far).

                      Thanks,
                      Aaron

                      --- On Fri, 11/9/12, Jaco Strauss <jacostrauss@...> wrote:

                      From: Jaco Strauss <jacostrauss@...>
                      Subject: Re: L1198 / Z 185
                      To: "I-M223" <I-M223@yahoogroups.com>
                      Date: Friday, November 9, 2012, 5:38 AM



                      Hi Aaron

                      As you know I am Z78+ but L1198- and Z79-

                      From the Project I understand that Z78+ also means that I would be 
                      M223+ >Z161+ >L801+ Z76+

                      Downstream from Z78 we seem to have something like:

                      Z78+ > L1198+ >Z185+ > Z171+ > Z79+
                      or 
                      Z78+ > L1198+ > Z171+ >Z185+ > Z79+
                      or
                      Z78+ > Z185+ > Z171+ > L1198+ >Z79+
                      etc...

                      Looking at current results as published by http://www.semargl.me/en/dna/ydna/item-snp/1397/ one can deduce the following:

                      NORRIS      Z78+ > L1198+ >Z185+ > Z171? Z79+
                      HAKULI       Z78+ > L1198+ >Z185? > Z171? Z79+
                      MCCALL     Z78+ > L1198+ >Z185+ > Z171+ Z79-
                      WAALKES  Z78+ > L1198+ >Z185+ > Z171? Z79-
                      GRIJPSTRA Z78+ > L1198+ >Z185? > Z171? Z79-
                      NIELSON     Z78+ > L1198- >Z185- > Z171? Z79-
                      STRAUSS    Z78+ > L1198- >Z185? > Z171? Z79-

                      When looking at this list, it really looks as if Z185 and Z171 could be downstream from L1198. But for that to be confirmed we need NORRIS, HAKULI, GRIJPSTRA or WAALKES to post a negative result for them.

                      In the case of me (STRAUSS) and NIELSON any positive result would place them upstream of L1198 for which we tested negative. 

                      I have recently ordered FF tests for both my parents as well as my wife so held back a little on more SNP testing. If I were to test either Z185 or Z171 first, which would be expected to be the more helpful?

                      Regards

                      -- 
                      Jaco Strauss
                      Cape Town


                      Thu Nov 8, 2012 4:08 am (PST) . Posted by:

                      "sallfertorr" sallfertorr

                      Hello, all

                      It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.

                      Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.

                      Thanks,
                      Aaron Torres


                    • Aaron Salles Torres
                      Hello, Jaco This tree is inaccurate. We cannot say that Z185 is downstream from L1198. People are jumping to that conclusion too quickly because L1198+ people
                      Message 10 of 14 , Nov 14, 2012
                      • 0 Attachment


                        Hello, Jaco

                        This tree is inaccurate. We cannot say that Z185 is downstream from L1198. People are jumping to that conclusion too quickly because L1198+ people have also turned out to be Z185+. But again, not enough L1198- people have tested. Z185 may be immediately upstream from L1198 and they may have occurred in a small historical interval. As an example, all L1198+ individuals are also Z78+, which doesn't mean Z78 is downstream from L1198, quite the contrary.

                        I would not recommend testing for this SNP within your L1198- group if I knew Z185's position on the tree and if I were certain you'd be negative. We're still in the investigatory phase, that is why your results are so useful (both with regards to Z185 and Z171). Anyone who says they know anything about Z185 and Z171 are doing guess work, not scientific research.

                        Thanks,
                        Aaron Torres

                        --- On Wed, 11/14/12, Jaco Strauss <jacostrauss@...> wrote:

                        From: Jaco Strauss <jacostrauss@...>
                        Subject: Re: L1198 / Z 185
                        To: "Aaron Salles Torres" <sallestorres@...>
                        Cc: "I-M223" <I-M223@yahoogroups.com>
                        Date: Wednesday, November 14, 2012, 7:04 AM


                        Hi Aaron

                        I see Ken Nordtvedt has placed Z185 downstream of L1198. http://knordtvedt.home.bresnan.net/Tree for M223+.pdf

                        I am negative for L1198 and have already tested for the downstream Z79. I would really not like to test for some other SNP downstream of one I am already negative for. 

                        Z171 at least has an outside chance of being upstream of L1198. Or do you disagree with Ken's tree?

                        Regards

                        Jaco



                        2012/11/9 Aaron Salles Torres <sallestorres@...>
                        Hello, Jaco

                        No conclusions can be reached about Z185 and Z171 yet. We need more results to know if these SNP's can be helpful breaking down the L1198- community. That is why I am encouraging tests within Z78* individuals (all L1198+ individuals have been positive for these SNP's so far).

                        Thanks,
                        Aaron

                        --- On Fri, 11/9/12, Jaco Strauss <jacostrauss@...> wrote:

                        From: Jaco Strauss <jacostrauss@...>
                        Subject: Re: L1198 / Z 185
                        To: "I-M223" <I-M223@yahoogroups.com>
                        Date: Friday, November 9, 2012, 5:38 AM



                        Hi Aaron

                        As you know I am Z78+ but L1198- and Z79-

                        From the Project I understand that Z78+ also means that I would be 
                        M223+ >Z161+ >L801+ Z76+

                        Downstream from Z78 we seem to have something like:

                        Z78+ > L1198+ >Z185+ > Z171+ > Z79+
                        or 
                        Z78+ > L1198+ > Z171+ >Z185+ > Z79+
                        or
                        Z78+ > Z185+ > Z171+ > L1198+ >Z79+
                        etc...

                        Looking at current results as published by http://www.semargl.me/en/dna/ydna/item-snp/1397/ one can deduce the following:

                        NORRIS      Z78+ > L1198+ >Z185+ > Z171? Z79+
                        HAKULI       Z78+ > L1198+ >Z185? > Z171? Z79+
                        MCCALL     Z78+ > L1198+ >Z185+ > Z171+ Z79-
                        WAALKES  Z78+ > L1198+ >Z185+ > Z171? Z79-
                        GRIJPSTRA Z78+ > L1198+ >Z185? > Z171? Z79-
                        NIELSON     Z78+ > L1198- >Z185- > Z171? Z79-
                        STRAUSS    Z78+ > L1198- >Z185? > Z171? Z79-

                        When looking at this list, it really looks as if Z185 and Z171 could be downstream from L1198. But for that to be confirmed we need NORRIS, HAKULI, GRIJPSTRA or WAALKES to post a negative result for them.

                        In the case of me (STRAUSS) and NIELSON any positive result would place them upstream of L1198 for which we tested negative. 

                        I have recently ordered FF tests for both my parents as well as my wife so held back a little on more SNP testing. If I were to test either Z185 or Z171 first, which would be expected to be the more helpful?

                        Regards

                        -- 
                        Jaco Strauss
                        Cape Town


                        Thu Nov 8, 2012 4:08 am (PST) . Posted by:

                        "sallfertorr" sallfertorr

                        Hello, all

                        It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.

                        Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.

                        Thanks,
                        Aaron Torres


                      • joaobraz_2000
                        Hello all, I m Z185+ ... so no suprise I guess since all L1198+ people have tested + for this SNP so far). Waiting on F3195 test result now ... JOAO
                        Message 11 of 14 , May 7 8:09 AM
                        • 0 Attachment
                          Hello all,

                          I'm Z185+ ... so no suprise I guess since all L1198+ people have tested + for this SNP so far). Waiting on F3195 test result now ...

                          JOAO



                          --- In I-M223@yahoogroups.com, Aaron Salles Torres <sallfertorr@...> wrote:
                          >
                          >
                          >
                          > Hello, Jaco
                          >
                          > This tree is inaccurate. We cannot say that Z185 is downstream from L1198. People are jumping to that conclusion too quickly because L1198+ people have also turned out to be Z185+. But again, not enough L1198- people have tested. Z185 may be immediately upstream from
                          > L1198 and they may have occurred in a small historical interval. As an example, all L1198+ individuals are also Z78+, which doesn't mean Z78 is downstream from L1198, quite the contrary.
                          >
                          > I would not recommend testing for this SNP within your L1198- group if I knew Z185's position on the tree and if I were certain you'd be negative. We're still in the investigatory phase, that is why your results are so useful (both with regards to Z185 and Z171). Anyone who says they know anything about Z185 and Z171 are doing guess work, not scientific research.
                          >
                          > Thanks,
                          > Aaron
                          > Torres
                          >
                          > --- On Wed, 11/14/12, Jaco Strauss <jacostrauss@...> wrote:
                          >
                          > From: Jaco Strauss <jacostrauss@...>
                          > Subject: Re: L1198 / Z 185
                          > To: "Aaron Salles Torres" <sallestorres@...>
                          > Cc: "I-M223" <I-M223@yahoogroups.com>
                          > Date: Wednesday, November 14, 2012, 7:04 AM
                          >
                          >
                          > Hi Aaron
                          > I see Ken Nordtvedt has placed Z185 downstream of L1198. http://knordtvedt.home.bresnan.net/Tree for M223+.pdf
                          >
                          > I am negative for L1198 and have already tested for the downstream Z79. I would really not like to test for some other SNP downstream of one I am already negative for. 
                          >
                          > Z171 at least has an outside chance of being upstream of L1198. Or do you disagree with Ken's tree?
                          >
                          > Regards
                          > Jaco
                          >
                          >
                          >
                          >
                          > 2012/11/9 Aaron Salles Torres <sallestorres@...>
                          >
                          >
                          > Hello, Jaco
                          >
                          > No conclusions can be reached about Z185 and Z171 yet. We need more results to know if these SNP's can be helpful breaking down the L1198- community. That is why I am encouraging tests within Z78* individuals (all L1198+ individuals have been positive for these SNP's so far).
                          >
                          >
                          >
                          > Thanks,
                          > Aaron
                          >
                          > --- On Fri, 11/9/12, Jaco Strauss <jacostrauss@...> wrote:
                          >
                          >
                          >
                          > From: Jaco Strauss <jacostrauss@...>
                          > Subject: Re: L1198 / Z 185
                          > To: "I-M223" <I-M223@yahoogroups.com>
                          >
                          >
                          > Date: Friday, November 9, 2012, 5:38 AM
                          >
                          >
                          > Hi Aaron
                          > As you know I am Z78+ but L1198- and Z79-
                          > From the Project I understand that
                          > Z78+ also means that I would be M223+ >Z161+ >L801+ Z76+
                          >
                          > Downstream from Z78 we seem to have something like:
                          > Z78+ > L1198+ >Z185+ > Z171+ > Z79+
                          > or Z78+ > L1198+ > Z171+ >Z185+ > Z79+
                          >
                          >
                          > orZ78+ > Z185+ > Z171+ > L1198+ >Z79+etc...
                          > Looking at current results as published by http://www.semargl.me/en/dna/ydna/item-snp/1397/%c2%a0one can deduce the following:
                          >
                          >
                          >
                          > NORRIS      Z78+ > L1198+ >Z185+ > Z171? Z79+HAKULI       Z78+ > L1198+ >Z185? > Z171? Z79+MCCALL     Z78+ > L1198+ >Z185+ > Z171+ Z79-
                          >
                          > WAALKES  Z78+ > L1198+ >Z185+ > Z171? Z79-
                          >
                          > GRIJPSTRA Z78+ > L1198+ >Z185? > Z171? Z79-NIELSON     Z78+ > L1198- >Z185- > Z171? Z79-
                          > STRAUSS    Z78+ > L1198- >Z185? > Z171? Z79-
                          >
                          >
                          >
                          > When looking at this list, it really looks as if Z185 and Z171 could be downstream from L1198. But for that to be confirmed we need NORRIS, HAKULI, GRIJPSTRA or WAALKES to post a negative result for them.
                          >
                          >
                          >
                          > In the case of me (STRAUSS) and NIELSON any positive result would place them upstream of L1198 for which we tested negative. 
                          > I have recently ordered FF tests for both my parents as well as my wife so held back a little on more SNP testing. If I were to test either Z185 or Z171 first, which would be expected to be the more helpful?
                          >
                          >
                          >
                          > Regards
                          > -- 
                          > Jaco Strauss
                          > Cape Town
                          >
                          >
                          >
                          >
                          >
                          >
                          > 1aRe: L1198 / Z 185
                          >
                          >
                          >
                          >
                          >
                          > Thu Nov 8, 2012 4:08 am (PST) . Posted by:"sallfertorr" sallfertorr
                          >
                          >
                          > Hello, all
                          >
                          > It is too early to say that L1198 and Z185 are phyloequivalent. We need Cont1 individuals to test Z78 and L1198.
                          >
                          >
                          >
                          >
                          > Then, we need Z78* members to test Z185 and Z171. We do not have nearly enough results to reach any conclusions yet.
                          >
                          > Thanks,
                          > Aaron Torres
                          >
                        • joaobraz_2000
                          Hello all, Regarding the position of Z185 in the tree, I went through the SNP list on FTDNA and noticed that all Z190+ that tested for Z185 are positive for
                          Message 12 of 14 , May 7 9:56 AM
                          • 0 Attachment
                            Hello all,

                            Regarding the position of Z185 in the tree, I went through the SNP list on FTDNA and noticed that all Z190+ that tested for Z185 are positive for that SNP. I'm L1198+ and Z185+ but Z190- ... so doesn't that mean that Z185 is upstream (or phylo-equivalent) from L1198 and not downstream? Thanks!

                            JOAO
                            kit 260237

                            --- In I-M223@yahoogroups.com, Brian McCall <mccallbrian568@...> wrote:
                            >
                            > I am L1198. I tested for  Z185. I was Z185+. I read the Genome 1000 Z185 predictions.
                            > I read the recommendstions on the I-M223 group divisions.
                            >  
                            > I do not recall. Z185 every discussed, as phylo-equivalant to L1198. That is the way. I read it.
                            > Brian
                            >
                          • Adam Waalkes
                            Weird. I am L1198+ but Z190-. I was told not to test Z185 because they thought it was downstream of Z190.   Adam Weird. I am L1198+ but Z190-. I was told
                            Message 13 of 14 , May 8 3:13 PM
                            • 0 Attachment
                              Weird. I am L1198+ but Z190-. I was told not to test Z185 because they thought it was downstream of Z190.
                               
                              Adam
                            • sallfertorr
                              Hello, Adam and João Z185 is somewhere downstream from Z78. However, we have not yet been able to establish its relationship with L1198 (they are very close
                              Message 14 of 14 , May 9 6:33 AM
                              • 0 Attachment
                                Hello, Adam and João

                                Z185 is somewhere downstream from Z78. However, we have not yet been able to establish its relationship with L1198 (they are very close and may or may not be phyloequivalent). One thing is for sure: Z185 is not downstream from Z190. It is upstream from it.

                                For those who are L1198+, I recommend testing F3195.

                                Thank you,
                                Aaron Torres


                                --- In I-M223@yahoogroups.com, Adam Waalkes <adam_waalkes@...> wrote:
                                >
                                > Weird. I am L1198+ but Z190-. I was told not to test Z185 because they thought it was downstream of Z190.
                                >  
                                > Adam
                                >
                              Your message has been successfully submitted and would be delivered to recipients shortly.