Loading ...
Sorry, an error occurred while loading the content.

1151Institute for Genetic Genealogy Conference - kRAHN slides, YSEQ, YFULL

Expand Messages
  • lairdkinna
    Aug 20, 2014
    • 0 Attachment

      I am hitting you with a lot in this message, but all the parts work together for us to get answers about the various haplogroups and SNPs for our different/unrelated Gillespie kits and subgroups. This is how I, and other project administrators, work behind the scenes for the projects.

      Cheers,

      Connie McKenzie - Gillespie DNP Project Volunteer Admin.


      ===================================================================


      Thomas Krahn has made the slides from his presentation at the August 2014 Institute for Genetic Genealogy conference available online:


      https://dl.dropboxusercontent.com/u/5676413/2014-08_I4GG.pdf


      Thomas Krahn and his wife Astrid previously ran the lab at Family Tree DNA. They left FTDNA about one year ago and now run their own lab (YSEQ located in Houston, TX) specifically for advanced SNP testing. The Krahns had their own lab in Germany prior to joining FTDNA some years ago. Many of us now utilize YSEQ for advanced SNP testing. Many times YSEQ makes newly discovered SNPs available for testing more quickly than FTDNA. Their cost is also a bit lower than FTDNA and they have sales sometimes. However, new DNA samples must be sent to YSEQ and although you will know your SNP test results, they cannot be transferred to FTDNA.  Just notify FTDNA project administrators about your results so they can make note of them.


      http://www.yseq.net/


      http://ybrowse.isogg.org/cgi-bin/gb2/gbrowse/chrY/


      The Krahn's also maintain a website called YBROWSE which provides additional information about SNPs.  At the top left of the YBROWSE page you will see SEARCH and under that LANDMARK or REGION. Clear any info in the section just to the left of the SEARCH button and type in the name of the SNP you are researching. For instance, type in our GILLESPIE GROUP 1 SNP L126 and click on SEARCH.  The International Society of Genetic Genealogists  http://www.isogg.org/  offered to sponsor YBROWSE on through their website when the Krahn's left FTDNA. The one very useful thing we did lose when the Krahn's left FTDNA was the SNP DRAFT TREE created by Thomas Krahn.  FTDNA removed the DRAFT TREE from it's website. This was a loss for all of us.  Now haplogroup project admins and other hobbist volunteers are doing their best to maintain draft trees for their own sections of the overall tree.



      Wait a minute and then YBROWSE will present L126 below under DETAILS SNPs.

      You will see L126 and S165.  L126 and S165 are the same SNP, but were given different names by two different sources. S SNPs come from Jim Wilson BritainsDNA. L126 came from Thomas Krahn when he was at the FTDNA lab.


      Click on either SNP name and you will be directed to another page with additional information about those SNPs. Click on S165 and you will see "comments: AKA L126.


      S165 Details


      Name: S165

      Type: snp

      Source: point

      Position: ChrY:14901633..14901633 (+ strand)

      Length: 1

      ISOGG_haplogroup: I2a2a1a1a

      YCC_haplogroup: I2b1a1

      allele_anc: C

      allele_der: T

      comments: Aka. L126

      count_derived: 0

      count_tested: 0

      mutation: C to T

      primer_f: TBD

      primer_r: TBD

      ref: Jim Wilson

      primary_id: 33807

      gbrowse_dbid: chrY:database

      >S165 class=Sequence position=ChrY:14901633..14901633 (+ strand)

      C



      Name: L126

      Type: snp

      Source: point

      Position: ChrY:14901633..14901633 (+ strand)

      Length: 1

      ISOGG_haplogroup: I2a2a1a1a

      YCC_haplogroup: I2b1a1

      allele_anc: C

      allele_der: T

      comments: derived in I-M284

      count_derived: 109

      count_tested: 749

      mutation: C to T

      primer_f: L126_F GGAGGGAGAGGTTGTAGTGAGTC

      primer_r: L126_R ACTACACACGTAGTAACACCCTGG

      ref: Thomas Krahn (FTDNA)

      primary_id: 33806

      gbrowse_dbid: chrY:database

      >L126 class=Sequence position=ChrY:14901633..14901633 (+ strand)

      C




      EXPERIMENTAL Y TREE at YFULL.


      Another company called YFULL is maintaining their own version of a draft tree.


      YFULL offers to analyze BIGY raw data for testees for a fee of $49.  I have now seen an analysis report from YFULL and I am impressed.


      http://www.yfull.com/


      http://www.yfull.com/tree/


      Go to the YFULL Experimental Tree and click on "I" for Haplogroup I (L126 belongs to Haplogroup I). You will then see the SNPs that belong to Haplogroup I. Do a page search to locate L126.


      http://www.yfull.com/tree/I/


      YFULL doesn't have all of the newest SNPs that are know to be downstream from L126. They have the known SNPs and new SNPs that were included in the raw data of individuals that sent  YFULL their raw data for analysis. 


      You will see tree entries such as " id:YF1877 new. Other id numbers show SCT or IRE indicating the country of origin for the earliest ancestor of those testees.


      YF1877 is the YFULL identification number for Gillespie Group 1 kit B6098 who submitted his raw data for analysis at YFULL. The BIGY test and analysis at YFULL confirmed a new SNP downstream fro L126 for Gillespie kit B6098.  YFULL gave this new SNP then name of I-Y4750.  You can see that there are now five testees that have submitted their raw BIGY data to YFULL and are positive for Y4750.


      Right now Gillespie Group 1 is part of the L126 ISLES SCOT subgroup in the Haplogroup I project. The new SNP Y4750 will split the L126 ISLES SCOT group. We don't have enough results yet to determine whether this split will indicate geographic areas.


      The YFULL report for Gillespie testee B6098 also shows 10 new SNPs that are considered NOVEL and we will need to test other kits in Gillespie Group 1 for Y4750 and for these new NOVEL SNPs. However, these SNPs are not available for individual purchase anywhere right now.  I am hoping that these 10 NOVEL SNPs will help Gillespie Group 1 to branch the kits in this subgroup along closer family lines. We do not have a common ancestor for Group 1. That individual likely resided in SW Scotland or Ulster in the 1600s. Records during that time period are scarce, making our search very difficult.


      Wayne Roberts, a haplogroup I admin has asked FTDNA to offer Y4750 for individual purchase. I'll let everyone know when it is available.


      I have to send the date to FTDNA and YSEQ to see if those 10 NOVEL SNPs from testee B6098 can be made available for testing at FTDNA and YSEQ. I will update on this when I have more information.


      I2a M223>M284>L1195>L369/L137/L126>(Y4750 via BIGY) Isles-Scot, Kittler 16-15 (Grp 1)


      B6098  SamGillespie b1720 IRE>Sam1742UlsterCoNY>Ste Y4750 Ireland


      http://www.yfull.com/tree/I/

      The info below is from the YFULL EXPERIMENTAL TREE


      • I-L126F2696 * S10965 * Y4153 * Y4139 * S165/L126...
        • id:YF01741
        • I-L126*
        • I-Y4172Y4172
          • id:YF01775SCT
          • id:YF01915new
          • id:HG02536ACB
          • id:YF01688SCT
        • I-Y4750Y4752 * Y4753 * Y4750
          • id:YF01750SCT
          • id:YF01877new
          • id:YF01940new
          • id:YF01942new
          • id:YF01710IRL