Loading ...
Sorry, an error occurred while loading the content.

Re: [Ashkenazi-Q] Re: I Need to Clarify What I Mean by KhazarianConnection

Expand Messages
  • KRUPA
    A study published in 2004 by Stephen L. Zegura states that The mutational age of Q-P36*, the marker defining the entire Q lineage, is 17,700 ± 4,820 years
    Message 1 of 10 , Jun 17, 2008
    • 0 Attachment
      A study published in 2004 by Stephen L. Zegura states that "The
      mutational age of Q-P36*, the marker defining the entire Q
      lineage, is 17,700 ± 4,820 years BP", and that its original
      source is the region of the Altay Mountains near the borders of
      Russia, Mongolia, Kazakhstan, and China (Zegura 2004, pp.
      164-175).

      +

      Haplogroup Q (Y-DNA)
      From Wikipedia, the free encyclopedia
      Jump to: navigation, search
      Haplogroup Q
      Time of origin 15,000 to 20,000 BC
      Place of origin Ural or Siberia
      Ancestor P
      Defining mutations M242
      Typical members Selkups (~70%) and Kets (~95%)

      In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA
      haplogroup.

      Haplogroup Q is a branch of haplogroup P (M45). It is believed to
      have arisen in Siberia approximately 15,000 to 20,000 years ago.

      This haplogroup contains the patrilineal ancestors of many
      Siberians, Central Asians, and indigenous peoples of the
      Americas. Haplogroup Q Y-chromosomes are also found scattered at
      a low frequency throughout Eurasia.[1] This haplogroup is diverse
      despite its low frequency among most populations outside of
      Siberia or the Americas, and at least six primary subclades have
      been sampled and identified in modern populations.
      Contents
      [hide]

      * 1 Origins
      * 2 Technical specification of mutation
      * 3 Distribution
      * 4 Discovery of ancestral Q in the Indian subcontinent
      * 5 Subgroups
      * 6 References
      * 7 External links
      * 8 See also

      [edit] Origins

      A migration from Asia into Alaska across the Bering Strait was
      done by haplogroup Q populations approximately 15,000 years ago.
      This founding population spread throughout the Americas. In the
      Americas, a member of the founding population underwent a
      mutation, producing its descendant population defined by the M3
      SNP.

      [edit] Technical specification of mutation

      The technical details of M242 are:

      Nucleotide change: C to T
      Position (base pair): 180
      Total size (base pairs): 366
      Forward 5′→ 3′: aactcttgataaaccgtgctg
      Reverse 5′→ 3′: tccaatctcaattcatgcctc

      [edit] Distribution

      In the Old World the Q lineage and its many branches is largely
      found within a huge triangle defined by Norway in the West, Iran
      in the South and Mongolia in the East. There is also a rough
      correlation between the Turkic-speaking peoples of Central
      Eurasia and Q. The frequency of Q in Norway and Mongolia is
      about 4% while in the Iranian cities of Shiraz and Esfahan, the
      frequency runs between 6% and 8%; Iranian samples of haplogroup
      Q belong almost exclusively to the M25 defined subclade. In the
      middle of this triangle, in Uzbekistan and Turkmenistan, the
      frequency of Q runs between 10% and 14%. Only two groups in the
      Old World are majority Q groups. These are the Selkups (~70%)
      and Kets (~95%). They live in western and middle Siberia and are
      small in number, being just under 5,000 and 1,500, respectively.

      [edit] Discovery of ancestral Q in the Indian subcontinent

      A Biomed study observed an ancestral state Q* and a novel
      sub-branch Q5, not reported elsewhere, in Indian subcontinent,
      though in low frequency. A novel subgroup Q4 was identified
      recently which is also restricted to Indian subcontinent. The
      most plausible explanation for these observations could be an
      ancestral migration of individuals bearing ancestral lineage Q*
      to Indian subcontinent followed by an autochthonous
      differentiation to Q4 and Q5 sublineages later on. Thus the
      subcontinent has three novel Q lineages, an ancestral Q*
      (different from the Central Asian Q*), Q4 and Q5 unique to the
      subcontinent.

      [edit] Subgroups

      The subclades of Haplogroup Q with their defining mutation(s),
      according to the 2008 ISOGG tree:

      * Q (M242)
      o Q*
      o Q1 (P36.2)
      + Q1*
      + Q1a (MEH2)
      # Q1a*
      # Q1a1 (M120, M265/N14) Found at low
      frequency among Chinese, Koreans, Dungans, and Hazara[2][3]
      # Q1a2 (M25, M143) Found at low to moderate
      frequency among some populations of Southwest Asia, Central Asia,
      and Siberia
      # Q1a3 (M346)
      * Q1a3* Found at low frequency in
      Pakistan and India
      * Q1a3a (M3) Typical of indigenous
      peoples of the Americas
      o Q1a3a*
      o Q1a3a1 (M19) Found among some
      indigenous peoples of South America, such as the Ticuna and the
      Wayuu[4]
      o Q1a3a2 (M194)
      o Q1a3a3 (M199, P106, P292)
      # Q1a4 (P48)
      # Q1a5 (P89)
      # Q1a6 (M323) Found in a significant
      minority of Yemeni Jews
      + Q1b (M378) Found at low frequency among samples
      of Hazara and Sindhis

      [edit] References

      1. ^ High-Resolution SNPs and Microsatellite Haplotypes Point
      to a Single, Recent Entry of Native American Y Chromosomes into
      the Americas, Stephen L. Zegura, Tatiana M. Karafet et al., 2003
      2. ^ Supplementary Table 2: NRY haplogroup distribution in Han
      populations, from the online supplementary material for the
      article by Bo Wen et al., "Genetic evidence supports demic
      diffusion of Han culture," Nature 431, 302-305 (16 September
      2004)
      3. ^ Table 1: Y-chromosome haplotype frequencies in 49
      Eurasian populations, listed according to geographic region,
      from the article by R. Spencer Wells et al., "The Eurasian
      Heartland: A continental perspective on Y-chromosome diversity,"
      Proceedings of the National Academy of Sciences of the United
      States of America (August 28, 2001)
      4. ^ "Y-Chromosome Evidence for Differing Ancient Demographic
      Histories in the Americas," Maria-Catira Bortolini et al.,
      American Journal of Human Genetics 73:524-539, 2003


      From above data You will see, that if we will be placed in Q1b
      subgroup, that will be ,as it seems, final proof of recent
      Asiatic origin, as it if founded on Hazara people which are of
      Mongolian and Nort Chinese origin, like Ashina Clan of Gok-Turks
      and Khazars.


      Alfred Krupa
      FTDNA Ashina Royal Dynasty DNA administrator
      http://www.familytreedna.com/public/AshinaRoyalDynasty/
      ---------------------- T - C o m - - W e b m a i l ----------------------
      Ova poruka poslana je upotrebom T-Com Webmail usluge
      Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
      http://shopping.tportal.hr
    • KRUPA
      I have included article from Wikipedia, as it quote known and new findings. About Hazara people; http://en.wikipedia.org/wiki/Hazara_people ... Ova poruka
      Message 2 of 10 , Jun 17, 2008
      • 0 Attachment
        I have included article from Wikipedia, as it quote known and new
        findings.

        About Hazara people;
        http://en.wikipedia.org/wiki/Hazara_people
        ---------------------- T - C o m - - W e b m a i l ----------------------
        Ova poruka poslana je upotrebom T-Com Webmail usluge
        Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
        http://shopping.tportal.hr
      • Rebekah Canada
        Hi, That is High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas Stephen L.
        Message 3 of 10 , Jun 17, 2008
        • 0 Attachment
          Hi,

          That is
          High-Resolution SNPs and Microsatellite Haplotypes Point to a Single,
          Recent Entry of Native American Y Chromosomes into the Americas
          Stephen L. Zegura , Tatiana M. Karafet , Lev A. Zhivotovsky , and
          Michael F. Hammer
          MBE Advance Access published on January 1, 2004, DOI 10.1093/molbev/msh009.
          Mol Biol Evol 21: 164-175.

          The free text is here.
          http://mbe.oxfordjournals.org/cgi/reprint/21/1/164

          --
          Peace and Light,
          Rebekah
        • Dave Howard
          Barry, I have searched and searched and as far as I can find there is no study that attempts to define the yDNA makeup of the Khazarians. I have found several
          Message 4 of 10 , Jun 18, 2008
          • 0 Attachment
            Barry,

            I have searched and searched and as far as I can find there is no
            study that attempts to define the yDNA makeup of the Khazarians.

            I have found several references that say this would be an excellent
            future project.

            Additionally, when Khazar crumbled as a nation it merged with the
            Maygars and many of those people are in Hungary today. Many Hungarian
            Jewish people are modern descendants of those Khazars. There are still
            place names and Khazarian words in place in those areas.

            Khazarian apparently were like the inhabitants of the Caucasus
            mountains area, i.e. stocky build, light skin, red hair and light
            colored eyes.

            Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
            have that build, skin, hair and eye color. In fact, that is what I
            look like.

            Dave


            --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@... wrote:
            >
            >
            > Hello, Comrades,
            >
            > I have been under the impression that, since we have no Khazar DNA
            in any
            > database, we must rely on matches with neighboring peoples to
            determine whether
            > there is a demonstrable relationship between us and the Khazars.
            >
            > Those neighboring peoples include Georgians, Azeris, Armenians and
            Chechens.
            >
            > Does Haplotype Q occur frequently among these people? Does anyone know?
            >
            > Thanks.
            >
            >
            > Barry Zwick in Los Angeles
            >
            >
            > In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
            > mladen.krupa@... writes:
            >
            >
            >
            >
            > I am glad to see this further explanation from Dave.
            >
            > Well, I wanted to say that if we dont share mutation for Q1b it
            > will not disapprove Khazarian origin.
            > That is because it is normal that always there was a mixture of
            > population, including mixture of Q's (some will share this
            > "additional" mutation, some will not).
            > But, also as pointed by Dave earlier and now, and me somwhere in
            > the middle, we cannot look only on SNP's as they emerged
            > thousands of years of ago. Haplotypes will show us more recent
            > connection, even if we will not share mutation for Q1b
            > classification.
            >
            > I strongly believe that our Y-chromosome is of the Gok-Turk and
            > then Khazarian origin, and from maternal side we will share
            > Israelite origin (that is why we (some of us) have Levit
            > tradition).
            >
            > I will conclude this communication for today with one also
            > earlier mentioned fact: we are the only representatives of
            > Mongolic Race in Ashkenazi. There is no others; C,O..
            > Just we-the Q's.
            > It is very significant fact, as this truth separate us from any
            > Middle Eastern, or European group or race.
            > And also (as pointed earlier) because rulers of the Gok-Turk and
            > Khazarian Empire (Jewish Converts) are represented as people of
            > Mongolic Race. That exclude R1a, and R1a1, as well as other R's
            > as second non-israelite haplogroup.
            > It is just a leading, but I find all this far too much similar to
            > be mere coincidence.
            >
            > And for Mr.Biondo's interesting writing; we are all descendants
            > of people from Eastern African soil.
            >
            > Alfred
            >
            > Citiram Dave Howard <_dshoward@..._ (mailto:dshoward@...) >:
            >
            > > Prof. Krupa is correct that there is evidence that there was a
            > > Khazarian conversion and some of their DNA may have entered the
            > > Ashkenazi gene
            > > pool.
            > >
            > > This is not inconsistent with my point. We have no disagreement.
            > >
            > > My point is that the Khazars are not necessarily the source of our
            > > Haplogroup-Q Y-Chromosome. That they may have provided some of
            our DNA
            > > does not mean that they are also the source of our yDNA.
            > >
            > > If Haplogroup-Q yDNA was in the Khazarian group it will
            > > be interesting to see if they had the M378 SNP mutation. It will be
            > > interesting to see if we really have it as well.
            > >
            > > One does suspect the Khazars as a possible source in that our common
            > > ancestor lived within the last 1,000 years. However, his
            appearance may
            > > or may not coincide with the Khazarian period.
            > >
            > > That we may all share a common ancestor within the last 1,000
            years is
            > > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
            > > means by "New DNA" vs. "Old DNA." The STR mutations are recent
            events.
            > > Our SNP mutations took place thousands of years ago.
            > >
            > > You may find the Khazarian links Prof. Krupa provided to be
            interesting,
            > > as I
            > > did.
            > >
            > > At the same time make sure you read the excellent Wikipedia article
            > > that discusses the Khazars including the controversy caused by the
            > > book The Thirteenth Tribe as well as the current anti-semitic theory
            > > that is popular among Arab states today.
            > >
            > > _http://en.wikipediahttp://en.http://_
            > (http://en.wikipedia.org/wiki/Khazars)
            > > <_http://en.wikipediahttp://en.http://_
            > (http://en.wikipedia.org/wiki/Khazars) >
            > >
            > > Here is a brief snippet from the Wikipedia article. (I strongly
            > > recommend reading the whole article at the link. The referenced
            > > footnotes are in the full article.)
            > >
            > > The National Academy of Science study referred to below is
            included in
            > > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
            > > same yDNA pool.pdf." I encourage you to look it over.
            > >
            > > DNA Evidence
            > >
            > > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
            > > features of the Khazars, who were likely of Central Asian Turkish
            > > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
            > > also discredited the Khazar origin theory for the vast majority of
            > > Jews, including the Ashkenazi.
            > >
            > > A study published by the National Academy of Sciences found that "The
            > > results support the hypothesis that the paternal gene pools of Jewish
            > > communities from Europe, North Africa, and the Middle East descended
            > > from a common Middle Eastern ancestral population, and suggest that
            > > most Jewish communities have remained relatively isolated from
            > > neighboring non-Jewish communities during and after the Diaspora."
            > > [2]. Researchers express surprise at the remarkable genetic
            uniformity
            > > they found among modern Jews, no matter where the diaspora has become
            > > dispersed around the world. Contradicting the "mongrel" theory, DNA
            > > demonstrated substantially less inter-marriage among Jews over the
            > > last 3000 years than found in other populations.
            > >
            > > "The results accord with Jewish history and tradition and refute
            > > theories like those holding that Jewish communities consist mostly of
            > > converts from other faiths, or that they are descended from the
            > > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
            > >
            > > Morever, "The analysis provides genetic witness that these
            communities
            > > have, to a remarkable extent, retained their biological identity
            > > separate from their host populations, evidence of relatively little
            > > intermarriage or conversion into Judaism over the centuries." Id. And
            > > another finding, paradoxical but unsurprising, is that by the
            > > yardstick of the Y chromosome, the world's Jewish communities are
            > > closely related to Syrians and Palestinians[ closely related to
            > > are descended from a common ancestral population that inhabited the
            > > Middle East some four thousand years ago. Id.
            > >
            > > This study found that "The extremely close affinity of Jewish and
            > > non-Jewish Middle Eastern populations observed ... supports the
            > > hypothesis of a common Middle Eastern origin.",[45] as does the
            > > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
            > > population.[ population.[<WBR>19] So although Khazars could possibly
            > > into the modern Jewish population as we know it today, it is unlikely
            > > that they formed a large percentage of the ancestors of modern
            Jews.[46]
            > >
            > >
            > > Dave
            > >
            > >
            > >
            >
            > ---------------------------------<WBR>---------<WBR>- T - C o m
            ----------
            > Ova poruka poslana je upotrebom T-Com Webmail usluge
            > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
            > _http://shopping.http://sho_ (http://shopping.tportal.hr/)
            >
            >
            >
            >
            >
            >
            >
            >
            >
            > **************Vote for your city's best dining and nightlife. City's
            Best
            > 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
            >
          • KRUPA
            Dear Dave, You have pointed several interesting things. My grandfather was very short man - 162 cm only, like his brother and sister (buried alive in Dachau),
            Message 5 of 10 , Jun 18, 2008
            • 0 Attachment
              Dear Dave,

              You have pointed several interesting things.
              My grandfather was very short man - 162 cm only, like his brother
              and sister (buried alive in Dachau), very strong builded (pre-war
              amateur champion in boxing of Poland), round head, thin lipses,
              very white skin, dark-blue eyes. Something like blue asian.
              Later generations are taller, but not too tall, still white
              skinned, strong builded.
              My sister looked in chilhood like Chinese. I have two sisters and
              brother and we all was blonde up to some age.

              I have several Hungarian Jews and converts to Christianity, in my
              exact match and near exact match lists.
              But main direction is to todays Ukraine (western Khazaria).

              Dr.Greenspan told me that it will be very difficult to find
              usable DNA in Khazarian graves, due to local climate. And that
              actually nobody is planning to undertake research in that field,
              what is odd situation for my understanding of this matter.

              Allesandro,

              Capital letters was only to underline my idea. Nothing else. As
              matter in fact I didnt write so much in English for years now!
              I cannot explain why there is no other Asiatic haplogroups in
              Ashkenazi community. As You, I can only predict or assume what
              can be reason for such state in Ashkenazi genetic pool.
              But, I am ,after all taken in consideration,pretty much convinced
              that we are from Khazaria.
              Most of us, at least.

              One hypothesis; maybe we are direct descendants of the Jewish
              Imperial family of Khazaria, not of wider ruling class? Maybe
              that is why statues shows Mongolic features? Who knows what will
              come on surface in future!
              We can only make hypothesis by now, for such statement.

              Regards,

              Alfred




              Citiram Dave Howard <dshoward@...>:

              > Barry,
              >
              > I have searched and searched and as far as I can find there is no
              > study that attempts to define the yDNA makeup of the Khazarians.
              >
              > I have found several references that say this would be an excellent
              > future project.
              >
              > Additionally, when Khazar crumbled as a nation it merged with the
              > Maygars and many of those people are in Hungary today. Many Hungarian
              > Jewish people are modern descendants of those Khazars. There are still
              > place names and Khazarian words in place in those areas.
              >
              > Khazarian apparently were like the inhabitants of the Caucasus
              > mountains area, i.e. stocky build, light skin, red hair and light
              > colored eyes.
              >
              > Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
              > have that build, skin, hair and eye color. In fact, that is what I
              > look like.
              >
              > Dave
              >
              >
              > --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@... wrote:
              >>
              >>
              >> Hello, Comrades,
              >>
              >> I have been under the impression that, since we have no Khazar DNA
              > in any
              >> database, we must rely on matches with neighboring peoples to
              > determine whether
              >> there is a demonstrable relationship between us and the Khazars.
              >>
              >> Those neighboring peoples include Georgians, Azeris, Armenians and
              > Chechens.
              >>
              >> Does Haplotype Q occur frequently among these people? Does anyone know?
              >>
              >> Thanks.
              >>
              >>
              >> Barry Zwick in Los Angeles
              >>
              >>
              >> In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
              >> mladen.krupa@... writes:
              >>
              >>
              >>
              >>
              >> I am glad to see this further explanation from Dave.
              >>
              >> Well, I wanted to say that if we dont share mutation for Q1b it
              >> will not disapprove Khazarian origin.
              >> That is because it is normal that always there was a mixture of
              >> population, including mixture of Q's (some will share this
              >> "additional" mutation, some will not).
              >> But, also as pointed by Dave earlier and now, and me somwhere in
              >> the middle, we cannot look only on SNP's as they emerged
              >> thousands of years of ago. Haplotypes will show us more recent
              >> connection, even if we will not share mutation for Q1b
              >> classification.
              >>
              >> I strongly believe that our Y-chromosome is of the Gok-Turk and
              >> then Khazarian origin, and from maternal side we will share
              >> Israelite origin (that is why we (some of us) have Levit
              >> tradition).
              >>
              >> I will conclude this communication for today with one also
              >> earlier mentioned fact: we are the only representatives of
              >> Mongolic Race in Ashkenazi. There is no others; C,O..
              >> Just we-the Q's.
              >> It is very significant fact, as this truth separate us from any
              >> Middle Eastern, or European group or race.
              >> And also (as pointed earlier) because rulers of the Gok-Turk and
              >> Khazarian Empire (Jewish Converts) are represented as people of
              >> Mongolic Race. That exclude R1a, and R1a1, as well as other R's
              >> as second non-israelite haplogroup.
              >> It is just a leading, but I find all this far too much similar to
              >> be mere coincidence.
              >>
              >> And for Mr.Biondo's interesting writing; we are all descendants
              >> of people from Eastern African soil.
              >>
              >> Alfred
              >>
              >> Citiram Dave Howard <_dshoward@..._ (mailto:dshoward@...) >:
              >>
              >> > Prof. Krupa is correct that there is evidence that there was a
              >> > Khazarian conversion and some of their DNA may have entered the
              >> > Ashkenazi gene
              >> > pool.
              >> >
              >> > This is not inconsistent with my point. We have no disagreement.
              >> >
              >> > My point is that the Khazars are not necessarily the source of our
              >> > Haplogroup-Q Y-Chromosome. That they may have provided some of
              > our DNA
              >> > does not mean that they are also the source of our yDNA.
              >> >
              >> > If Haplogroup-Q yDNA was in the Khazarian group it will
              >> > be interesting to see if they had the M378 SNP mutation. It will be
              >> > interesting to see if we really have it as well.
              >> >
              >> > One does suspect the Khazars as a possible source in that our common
              >> > ancestor lived within the last 1,000 years. However, his
              > appearance may
              >> > or may not coincide with the Khazarian period.
              >> >
              >> > That we may all share a common ancestor within the last 1,000
              > years is
              >> > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
              >> > means by "New DNA" vs. "Old DNA." The STR mutations are recent
              > events.
              >> > Our SNP mutations took place thousands of years ago.
              >> >
              >> > You may find the Khazarian links Prof. Krupa provided to be
              > interesting,
              >> > as I
              >> > did.
              >> >
              >> > At the same time make sure you read the excellent Wikipedia article
              >> > that discusses the Khazars including the controversy caused by the
              >> > book The Thirteenth Tribe as well as the current anti-semitic theory
              >> > that is popular among Arab states today.
              >> >
              >> > _http://en.wikipediahttp://en.http://_
              >> (http://en.wikipedia.org/wiki/Khazars)
              >> > <_http://en.wikipediahttp://en.http://_
              >> (http://en.wikipedia.org/wiki/Khazars) >
              >> >
              >> > Here is a brief snippet from the Wikipedia article. (I strongly
              >> > recommend reading the whole article at the link. The referenced
              >> > footnotes are in the full article.)
              >> >
              >> > The National Academy of Science study referred to below is
              > included in
              >> > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
              >> > same yDNA pool.pdf." I encourage you to look it over.
              >> >
              >> > DNA Evidence
              >> >
              >> > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
              >> > features of the Khazars, who were likely of Central Asian Turkish
              >> > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
              >> > also discredited the Khazar origin theory for the vast majority of
              >> > Jews, including the Ashkenazi.
              >> >
              >> > A study published by the National Academy of Sciences found that "The
              >> > results support the hypothesis that the paternal gene pools of Jewish
              >> > communities from Europe, North Africa, and the Middle East descended
              >> > from a common Middle Eastern ancestral population, and suggest that
              >> > most Jewish communities have remained relatively isolated from
              >> > neighboring non-Jewish communities during and after the Diaspora."
              >> > [2]. Researchers express surprise at the remarkable genetic
              > uniformity
              >> > they found among modern Jews, no matter where the diaspora has become
              >> > dispersed around the world. Contradicting the "mongrel" theory, DNA
              >> > demonstrated substantially less inter-marriage among Jews over the
              >> > last 3000 years than found in other populations.
              >> >
              >> > "The results accord with Jewish history and tradition and refute
              >> > theories like those holding that Jewish communities consist mostly of
              >> > converts from other faiths, or that they are descended from the
              >> > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
              >> >
              >> > Morever, "The analysis provides genetic witness that these
              > communities
              >> > have, to a remarkable extent, retained their biological identity
              >> > separate from their host populations, evidence of relatively little
              >> > intermarriage or conversion into Judaism over the centuries." Id. And
              >> > another finding, paradoxical but unsurprising, is that by the
              >> > yardstick of the Y chromosome, the world's Jewish communities are
              >> > closely related to Syrians and Palestinians[ closely related to
              >> > are descended from a common ancestral population that inhabited the
              >> > Middle East some four thousand years ago. Id.
              >> >
              >> > This study found that "The extremely close affinity of Jewish and
              >> > non-Jewish Middle Eastern populations observed ... supports the
              >> > hypothesis of a common Middle Eastern origin.",[45] as does the
              >> > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
              >> > population.[ population.[<WBR>19] So although Khazars could possibly
              >> > into the modern Jewish population as we know it today, it is unlikely
              >> > that they formed a large percentage of the ancestors of modern
              > Jews.[46]
              >> >
              >> >
              >> > Dave
              >> >
              >> >
              >> >
              >>
              >> ---------------------------------<WBR>---------<WBR>- T - C o m
              > ----------
              >> Ova poruka poslana je upotrebom T-Com Webmail usluge
              >> Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
              >> _http://shopping.http://sho_ (http://shopping.tportal.hr/)
              >>
              >>
              >>
              >>
              >>
              >>
              >>
              >>
              >>
              >> **************Vote for your city's best dining and nightlife. City's
              > Best
              >> 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
              >>
              >
              >
              >


              ---------------------- T - C o m - - W e b m a i l ----------------------
              Ova poruka poslana je upotrebom T-Com Webmail usluge
              Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
              http://shopping.tportal.hr
            • Alessandro Biondo
              Alfred, First of all, let me explain that, because we are dealing with such a difficult matter, it may happen that some misunderstanding arrive. We are more
              Message 6 of 10 , Jun 18, 2008
              • 0 Attachment
                Alfred,

                First of all, let me explain that, because we are dealing with such a
                difficult matter, it may happen that some misunderstanding arrive. We
                are more subject to misunderstandig because we need to explain, and
                understand, such complex topics in a language that is foreign for
                both us: I hope our american friends and you will excuse me if
                sometime something is not enough clear in my comments or enough
                understood by me.
                Let me add that I think that these days we are learning something one
                other's. The discussions are useful for this reason, even if
                something they are a bit frustrating, for the difficult to deal with
                complex matters, and to express these matters in a intelligible way.
                For the question of the lack of asian haplogroup, this discussion
                bring me to do some further thinking, and maybe there is a possible,
                biological reason: founder's effect. But I am not a scientist, so I
                don't know if this effect can apply to the history of the Jewish
                people in Europe: for sure there is an isolation, but I don't know if
                there was enough isolation, and if enough time passed to leave the
                founder's effect free to act. So we are again chained at the same
                point: we need more data and more, deeper, axplanations about more
                facts. But in the future, with more data (biology, archaeology,
                history and other fields can offer their contribute) and maybe also
                with some little help from thoughts from the different peoples
                commenting in this group, we have the hope to dominate a larger
                picture of our roots.

                Friendly.

                Alessandro.

                --- In Ashkenazi-Q@yahoogroups.com, KRUPA <mladen.krupa@...> wrote:
                >
                > Dear Dave,
                >
                > You have pointed several interesting things.
                > My grandfather was very short man - 162 cm only, like his brother
                > and sister (buried alive in Dachau), very strong builded (pre-war
                > amateur champion in boxing of Poland), round head, thin lipses,
                > very white skin, dark-blue eyes. Something like blue asian.
                > Later generations are taller, but not too tall, still white
                > skinned, strong builded.
                > My sister looked in chilhood like Chinese. I have two sisters and
                > brother and we all was blonde up to some age.
                >
                > I have several Hungarian Jews and converts to Christianity, in my
                > exact match and near exact match lists.
                > But main direction is to todays Ukraine (western Khazaria).
                >
                > Dr.Greenspan told me that it will be very difficult to find
                > usable DNA in Khazarian graves, due to local climate. And that
                > actually nobody is planning to undertake research in that field,
                > what is odd situation for my understanding of this matter.
                >
                > Allesandro,
                >
                > Capital letters was only to underline my idea. Nothing else. As
                > matter in fact I didnt write so much in English for years now!
                > I cannot explain why there is no other Asiatic haplogroups in
                > Ashkenazi community. As You, I can only predict or assume what
                > can be reason for such state in Ashkenazi genetic pool.
                > But, I am ,after all taken in consideration,pretty much convinced
                > that we are from Khazaria.
                > Most of us, at least.
                >
                > One hypothesis; maybe we are direct descendants of the Jewish
                > Imperial family of Khazaria, not of wider ruling class? Maybe
                > that is why statues shows Mongolic features? Who knows what will
                > come on surface in future!
                > We can only make hypothesis by now, for such statement.
                >
                > Regards,
                >
                > Alfred
                >
                >
                >
                >
                > Citiram Dave Howard <dshoward@...>:
                >
                > > Barry,
                > >
                > > I have searched and searched and as far as I can find there is no
                > > study that attempts to define the yDNA makeup of the Khazarians.
                > >
                > > I have found several references that say this would be an
                excellent
                > > future project.
                > >
                > > Additionally, when Khazar crumbled as a nation it merged with the
                > > Maygars and many of those people are in Hungary today. Many
                Hungarian
                > > Jewish people are modern descendants of those Khazars. There are
                still
                > > place names and Khazarian words in place in those areas.
                > >
                > > Khazarian apparently were like the inhabitants of the Caucasus
                > > mountains area, i.e. stocky build, light skin, red hair and light
                > > colored eyes.
                > >
                > > Forgetting about Haplogroup Q, I know many Ashkenazi Jewish
                people who
                > > have that build, skin, hair and eye color. In fact, that is what I
                > > look like.
                > >
                > > Dave
                > >
                > >
                > > --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@ wrote:
                > >>
                > >>
                > >> Hello, Comrades,
                > >>
                > >> I have been under the impression that, since we have no Khazar
                DNA
                > > in any
                > >> database, we must rely on matches with neighboring peoples to
                > > determine whether
                > >> there is a demonstrable relationship between us and the Khazars.
                > >>
                > >> Those neighboring peoples include Georgians, Azeris, Armenians
                and
                > > Chechens.
                > >>
                > >> Does Haplotype Q occur frequently among these people? Does
                anyone know?
                > >>
                > >> Thanks.
                > >>
                > >>
                > >> Barry Zwick in Los Angeles
                > >>
                > >>
                > >> In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
                > >> mladen.krupa@ writes:
                > >>
                > >>
                > >>
                > >>
                > >> I am glad to see this further explanation from Dave.
                > >>
                > >> Well, I wanted to say that if we dont share mutation for Q1b it
                > >> will not disapprove Khazarian origin.
                > >> That is because it is normal that always there was a mixture of
                > >> population, including mixture of Q's (some will share this
                > >> "additional" mutation, some will not).
                > >> But, also as pointed by Dave earlier and now, and me somwhere in
                > >> the middle, we cannot look only on SNP's as they emerged
                > >> thousands of years of ago. Haplotypes will show us more recent
                > >> connection, even if we will not share mutation for Q1b
                > >> classification.
                > >>
                > >> I strongly believe that our Y-chromosome is of the Gok-Turk and
                > >> then Khazarian origin, and from maternal side we will share
                > >> Israelite origin (that is why we (some of us) have Levit
                > >> tradition).
                > >>
                > >> I will conclude this communication for today with one also
                > >> earlier mentioned fact: we are the only representatives of
                > >> Mongolic Race in Ashkenazi. There is no others; C,O..
                > >> Just we-the Q's.
                > >> It is very significant fact, as this truth separate us from any
                > >> Middle Eastern, or European group or race.
                > >> And also (as pointed earlier) because rulers of the Gok-Turk and
                > >> Khazarian Empire (Jewish Converts) are represented as people of
                > >> Mongolic Race. That exclude R1a, and R1a1, as well as other R's
                > >> as second non-israelite haplogroup.
                > >> It is just a leading, but I find all this far too much similar
                to
                > >> be mere coincidence.
                > >>
                > >> And for Mr.Biondo's interesting writing; we are all descendants
                > >> of people from Eastern African soil.
                > >>
                > >> Alfred
                > >>
                > >> Citiram Dave Howard <_dshoward@_ (mailto:dshoward@) >:
                > >>
                > >> > Prof. Krupa is correct that there is evidence that there was a
                > >> > Khazarian conversion and some of their DNA may have entered
                the
                > >> > Ashkenazi gene
                > >> > pool.
                > >> >
                > >> > This is not inconsistent with my point. We have no
                disagreement.
                > >> >
                > >> > My point is that the Khazars are not necessarily the source
                of our
                > >> > Haplogroup-Q Y-Chromosome. That they may have provided some of
                > > our DNA
                > >> > does not mean that they are also the source of our yDNA.
                > >> >
                > >> > If Haplogroup-Q yDNA was in the Khazarian group it will
                > >> > be interesting to see if they had the M378 SNP mutation. It
                will be
                > >> > interesting to see if we really have it as well.
                > >> >
                > >> > One does suspect the Khazars as a possible source in that our
                common
                > >> > ancestor lived within the last 1,000 years. However, his
                > > appearance may
                > >> > or may not coincide with the Khazarian period.
                > >> >
                > >> > That we may all share a common ancestor within the last 1,000
                > > years is
                > >> > based on our STRs and not our SNPs. I believe this is what
                Prof. Kupa
                > >> > means by "New DNA" vs. "Old DNA." The STR mutations are recent
                > > events.
                > >> > Our SNP mutations took place thousands of years ago.
                > >> >
                > >> > You may find the Khazarian links Prof. Krupa provided to be
                > > interesting,
                > >> > as I
                > >> > did.
                > >> >
                > >> > At the same time make sure you read the excellent Wikipedia
                article
                > >> > that discusses the Khazars including the controversy caused
                by the
                > >> > book The Thirteenth Tribe as well as the current anti-semitic
                theory
                > >> > that is popular among Arab states today.
                > >> >
                > >> > _http://en.wikipediahttp://en.http://_
                > >> (http://en.wikipedia.org/wiki/Khazars)
                > >> > <_http://en.wikipediahttp://en.http://_
                > >> (http://en.wikipedia.org/wiki/Khazars) >
                > >> >
                > >> > Here is a brief snippet from the Wikipedia article. (I
                strongly
                > >> > recommend reading the whole article at the link. The
                referenced
                > >> > footnotes are in the full article.)
                > >> >
                > >> > The National Academy of Science study referred to below is
                > > included in
                > >> > our "Files" section entitled "Jewish and non-Jewish Middle
                Easterners
                > >> > same yDNA pool.pdf." I encourage you to look it over.
                > >> >
                > >> > DNA Evidence
                > >> >
                > >> > Most Jews, including Ashkenazi Jews, do not exhibit the
                oriental
                > >> > features of the Khazars, who were likely of Central Asian
                Turkish
                > >> > origin. Modern DNA studies on the Y chromosome of Jews
                worldwide have
                > >> > also discredited the Khazar origin theory for the vast
                majority of
                > >> > Jews, including the Ashkenazi.
                > >> >
                > >> > A study published by the National Academy of Sciences found
                that "The
                > >> > results support the hypothesis that the paternal gene pools
                of Jewish
                > >> > communities from Europe, North Africa, and the Middle East
                descended
                > >> > from a common Middle Eastern ancestral population, and
                suggest that
                > >> > most Jewish communities have remained relatively isolated from
                > >> > neighboring non-Jewish communities during and after the
                Diaspora."
                > >> > [2]. Researchers express surprise at the remarkable genetic
                > > uniformity
                > >> > they found among modern Jews, no matter where the diaspora
                has become
                > >> > dispersed around the world. Contradicting the "mongrel"
                theory, DNA
                > >> > demonstrated substantially less inter-marriage among Jews
                over the
                > >> > last 3000 years than found in other populations.
                > >> >
                > >> > "The results accord with Jewish history and tradition and
                refute
                > >> > theories like those holding that Jewish communities consist
                mostly of
                > >> > converts from other faiths, or that they are descended from
                the
                > >> > Khazars, a medieval Turkish tribe that adopted Judaism." [3]
                [43]
                > >> >
                > >> > Morever, "The analysis provides genetic witness that these
                > > communities
                > >> > have, to a remarkable extent, retained their biological
                identity
                > >> > separate from their host populations, evidence of relatively
                little
                > >> > intermarriage or conversion into Judaism over the centuries."
                Id. And
                > >> > another finding, paradoxical but unsurprising, is that by the
                > >> > yardstick of the Y chromosome, the world's Jewish communities
                are
                > >> > closely related to Syrians and Palestinians[ closely related
                to
                > >> > are descended from a common ancestral population that
                inhabited the
                > >> > Middle East some four thousand years ago. Id.
                > >> >
                > >> > This study found that "The extremely close affinity of Jewish
                and
                > >> > non-Jewish Middle Eastern populations observed ... supports
                the
                > >> > hypothesis of a common Middle Eastern origin.",[45] as does
                the
                > >> > mitochondrial DNA (mtDNA) of at least 40% of the current
                Ashkenazi
                > >> > population.[ population.[<WBR>19] So although Khazars could
                possibly
                > >> > into the modern Jewish population as we know it today, it is
                unlikely
                > >> > that they formed a large percentage of the ancestors of modern
                > > Jews.[46]
                > >> >
                > >> >
                > >> > Dave
                > >> >
                > >> >
                > >> >
                > >>
                > >> ---------------------------------<WBR>---------<WBR>- T - C o m
                > > ----------
                > >> Ova poruka poslana je upotrebom T-Com Webmail usluge
                > >> Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                > >> _http://shopping.http://sho_ (http://shopping.tportal.hr/)
                > >>
                > >>
                > >>
                > >>
                > >>
                > >>
                > >>
                > >>
                > >>
                > >> **************Vote for your city's best dining and nightlife.
                City's
                > > Best
                > >> 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
                > >>
                > >
                > >
                > >
                >
                >
                > ---------------------- T - C o m - - W e b m a i l -----------------
                -----
                > Ova poruka poslana je upotrebom T-Com Webmail usluge
                > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                > http://shopping.tportal.hr
                >
              • Barryzwick@aol.com
                Thanks so much for all your research, Dave, not only on this but on other DNA questions. There is a conflict between Alfred s insistence that Khazars were
                Message 7 of 10 , Jun 18, 2008
                • 0 Attachment
                  Thanks so much for all your research, Dave, not only on this but on other DNA questions.
                   
                  There is a conflict between Alfred's insistence that Khazars were Mongolian and your own personal description. I suspect that red hair and light-colored eyes are rare among Mongolians. You can't both be right.
                   
                  As to whether the Khazars "merged" with the Magyars, I have never read that it was anything quite that concrete. The Khazars indeed left some traces in Hungary. Whether this was a mass movement is quite another matter. Since so many of the Khazars were Muslim, how could it come to be that Judaism survived among the Khazarian transplants, but Islam did not?
                   
                  Since the Khazars did not chronicle what became of themselves, we can only guess. They diverged strongly from the people among whom they lived, who kept track of every ruler, every harvest and every battle. The Khazars had no written language. This alone would have made their survival as Jews close to miraculous. They could have left records in Hebrew, true, but we have no evidence that they did.
                   
                  I'm afraid I remain a skeptic.
                   
                  I'm following this discussion with a great deal of interest. We are lucky that so many well-informed people share our genetic heritage.
                   
                  Barry
                   
                  Barry Zwick in Los Angeles
                   
                   
                  In a message dated 6/18/2008 11:29:29 A.M. Pacific Daylight Time, dshoward@... writes:

                  Barry,

                  I have searched and searched and as far as I can find there is no
                  study that attempts to define the yDNA makeup of the Khazarians.

                  I have found several references that say this would be an excellent
                  future project.

                  Additionally, when Khazar crumbled as a nation it merged with the
                  Maygars and many of those people are in Hungary today. Many Hungarian
                  Jewish people are modern descendants of those Khazars. There are still
                  place names and Khazarian words in place in those areas.

                  Khazarian apparently were like the inhabitants of the Caucasus
                  mountains area, i.e. stocky build, light skin, red hair and light
                  colored eyes.

                  Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
                  have that build, skin, hair and eye color. In fact, that is what I
                  look like.

                  Dave

                  --- In Ashkenazi-Q@ yahoogroups. com, Barryzwick@. .. wrote:
                  >
                  >
                  > Hello, Comrades,
                  >
                  > I have been under the impression that, since we have no Khazar DNA
                  in any
                  > database, we must rely on matches with neighboring peoples to
                  determine whether
                  > there is a demonstrable relationship between us and the Khazars.
                  >
                  > Those neighboring peoples include Georgians, Azeris, Armenians and
                  Chechens.
                  >
                  > Does Haplotype Q occur frequently among these people? Does anyone know?
                  >
                  > Thanks.
                  >
                  >
                  > Barry Zwick in Los Angeles
                  >
                  >
                  > In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
                  > mladen.krupa@ ... writes:
                  >
                  >
                  >
                  >
                  > I am glad to see this further explanation from Dave.
                  >
                  > Well, I wanted to say that if we dont share mutation for Q1b it
                  > will not disapprove Khazarian origin.
                  > That is because it is normal that always there was a mixture of
                  > population, including mixture of Q's (some will share this
                  > "additional" mutation, some will not).
                  > But, also as pointed by Dave earlier and now, and me somwhere in
                  > the middle, we cannot look only on SNP's as they emerged
                  > thousands of years of ago. Haplotypes will show us more recent
                  > connection, even if we will not share mutation for Q1b
                  > classification.
                  >
                  > I strongly believe that our Y-chromosome is of the Gok-Turk and
                  > then Khazarian origin, and from maternal side we will share
                  > Israelite origin (that is why we (some of us) have Levit
                  > tradition).
                  >
                  > I will conclude this communication for today with one also
                  > earlier mentioned fact: we are the only representatives of
                  > Mongolic Race in Ashkenazi. There is no others; C,O..
                  > Just we-the Q's.
                  > It is very significant fact, as this truth separate us from any
                  > Middle Eastern, or European group or race.
                  > And also (as pointed earlier) because rulers of the Gok-Turk and
                  > Khazarian Empire (Jewish Converts) are represented as people of
                  > Mongolic Race. That exclude R1a, and R1a1, as well as other R's
                  > as second non-israelite haplogroup.
                  > It is just a leading, but I find all this far too much similar to
                  > be mere coincidence.
                  >
                  > And for Mr.Biondo's interesting writing; we are all descendants
                  > of people from Eastern African soil.
                  >
                  > Alfred
                  >
                  > Citiram Dave Howard <_dshoward@. .._ (mailto:dshoward@ ...) >:
                  >
                  > > Prof. Krupa is correct that there is evidence that there was a
                  > > Khazarian conversion and some of their DNA may have entered the
                  > > Ashkenazi gene
                  > > pool.
                  > >
                  > > This is not inconsistent with my point. We have no disagreement.
                  > >
                  > > My point is that the Khazars are not necessarily the source of our
                  > > Haplogroup-Q Y-Chromosome. That they may have provided some of
                  our DNA
                  > > does not mean that they are also the source of our yDNA.
                  > >
                  > > If Haplogroup-Q yDNA was in the Khazarian group it will
                  > > be interesting to see if they had the M378 SNP mutation. It will be
                  > > interesting to see if we really have it as well.
                  > >
                  > > One does suspect the Khazars as a possible source in that our common
                  > > ancestor lived within the last 1,000 years. However, his
                  appearance may
                  > > or may not coincide with the Khazarian period.
                  > >
                  > > That we may all share a common ancestor within the last 1,000
                  years is
                  > > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
                  > > means by "New DNA" vs. "Old DNA." The STR mutations are recent
                  events.
                  > > Our SNP mutations took place thousands of years ago.
                  > >
                  > > You may find the Khazarian links Prof. Krupa provided to be
                  interesting,
                  > > as I
                  > > did.
                  > >
                  > > At the same time make sure you read the excellent Wikipedia article
                  > > that discusses the Khazars including the controversy caused by the
                  > > book The Thirteenth Tribe as well as the current anti-semitic theory
                  > > that is popular among Arab states today.
                  > >
                  > > _http://en.wikipedia http://en. http://_
                  > (http://en.wikipedia .org/wiki/ Khazars)
                  > > <_http://en.wikipedia http://en. http://_
                  > (http://en.wikipedia .org/wiki/ Khazars) >
                  > >
                  > > Here is a brief snippet from the Wikipedia article. (I strongly
                  > > recommend reading the whole article at the link. The referenced
                  > > footnotes are in the full article.)
                  > >
                  > > The National Academy of Science study referred to below is
                  included in
                  > > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
                  > > same yDNA pool.pdf." I encourage you to look it over.
                  > >
                  > > DNA Evidence
                  > >
                  > > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
                  > > features of the Khazars, who were likely of Central Asian Turkish
                  > > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
                  > > also discredited the Khazar origin theory for the vast majority of
                  > > Jews, including the Ashkenazi.
                  > >
                  > > A study published by the National Academy of Sciences found that "The
                  > > results support the hypothesis that the paternal gene pools of Jewish
                  > > communities from Europe, North Africa, and the Middle East descended
                  > > from a common Middle Eastern ancestral population, and suggest that
                  > > most Jewish communities have remained relatively isolated from
                  > > neighboring non-Jewish communities during and after the Diaspora."
                  > > [2]. Researchers express surprise at the remarkable genetic
                  uniformity
                  > > they found among modern Jews, no matter where the diaspora has become
                  > > dispersed around the world. Contradicting the "mongrel" theory, DNA
                  > > demonstrated substantially less inter-marriage among Jews over the
                  > > last 3000 years than found in other populations.
                  > >
                  > > "The results accord with Jewish history and tradition and refute
                  > > theories like those holding that Jewish communities consist mostly of
                  > > converts from other faiths, or that they are descended from the
                  > > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
                  > >
                  > > Morever, "The analysis provides genetic witness that these
                  communities
                  > > have, to a remarkable extent, retained their biological identity
                  > > separate from their host populations, evidence of relatively little
                  > > intermarriage or conversion into Judaism over the centuries." Id. And
                  > > another finding, paradoxical but unsurprising, is that by the
                  > > yardstick of the Y chromosome, the world's Jewish communities are
                  > > closely related to Syrians and Palestinians[ closely related to
                  > > are descended from a common ancestral population that inhabited the
                  > > Middle East some four thousand years ago. Id.
                  > >
                  > > This study found that "The extremely close affinity of Jewish and
                  > > non-Jewish Middle Eastern populations observed ... supports the
                  > > hypothesis of a common Middle Eastern origin.",[45] as does the
                  > > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
                  > > population.[ population.[ <WBR>19] So although Khazars could possibly
                  > > into the modern Jewish population as we know it today, it is unlikely
                  > > that they formed a large percentage of the ancestors of modern
                  Jews.[46]
                  > >
                  > >
                  > > Dave
                  > >
                  > >
                  > >
                  >
                  > ------------ --------- --------- ---<WBR>- --------< WBR>- T - C o m
                  ----------
                  > Ova poruka poslana je upotrebom T-Com Webmail usluge
                  > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                  > _http://shopping. http://sho_ (http://shopping. tportal.hr/)
                  >
                  >
                  >
                  >
                  >
                  >
                  >
                  >
                  >
                  > ************ **Vote for your city's best dining and nightlife. City's
                  Best
                  > 2008. (http://citysbest. aol.com?ncid= aolacg0005000000 0102)
                  >

                   




                  Gas prices getting you down? Search AOL Autos for fuel-efficient used cars.
                • KRUPA
                  Barry, I am red, particulary in beard. Khazars used Turkic Runes, and later Hebrew. Alfred ... Ova poruka poslana je upotrebom T-Com Webmail usluge Uzivajte u
                  Message 8 of 10 , Jun 18, 2008
                  • 0 Attachment
                    Barry,

                    I am red, particulary in beard.

                    Khazars used Turkic Runes, and later Hebrew.


                    Alfred




                    ---------------------- T - C o m - - W e b m a i l ----------------------
                    Ova poruka poslana je upotrebom T-Com Webmail usluge
                    Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                    http://shopping.tportal.hr
                  Your message has been successfully submitted and would be delivered to recipients shortly.