Loading ...
Sorry, an error occurred while loading the content.

RE: [Ashkenazi-Q] I Need to Clarify What I Mean by KhazarianConnection

Expand Messages
  • Jason Vick
    http://en.wikipedia.org/wiki/Y-DNA_haplogroups_by_ethnic_groups Unfortunately, there isn t yet a column for Hg. Q. Jason F. Vick From:
    Message 1 of 10 , Jun 16, 2008
    • 0 Attachment

      http://en.wikipedia.org/wiki/Y-DNA_haplogroups_by_ethnic_groups

       

      Unfortunately, there isn’t yet a column for Hg. Q.

       

       Jason F. Vick

       

      From: Ashkenazi-Q@yahoogroups.com [mailto:Ashkenazi-Q@yahoogroups.com] On Behalf Of Barryzwick@...
      Sent: Sunday, June 15, 2008 5:56 PM
      To: Ashkenazi-Q@yahoogroups.com
      Subject: Re: [Ashkenazi-Q] I Need to Clarify What I Mean by KhazarianConnection

       

      Hello, Comrades,

       

      I have been under the impression that, since we have no Khazar DNA in any database, we must rely on matches with neighboring peoples to determine whether there is a demonstrable relationship between us and the Khazars.

       

      Those neighboring peoples include Georgians, Azeris, Armenians and Chechens.

       

      Does Haplotype Q occur frequently among these people? Does anyone know?

       

      Thanks.

       

       

      Barry Zwick in Los Angeles

       

       

      In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time, mladen.krupa@ka.t-com.hr writes:

      I am glad to see this further explanation from Dave.

      Well, I wanted to say that if we dont share mutation for Q1b it
      will not disapprove Khazarian origin.
      That is because it is normal that always there was a mixture of
      population, including mixture of Q's (some will share this
      "additional" mutation, some will not).
      But, also as pointed by Dave earlier and now, and me somwhere in
      the middle, we cannot look only on SNP's as they emerged
      thousands of years of ago. Haplotypes will show us more recent
      connection, even if we will not share mutation for Q1b
      classification.

      I strongly believe that our Y-chromosome is of the Gok-Turk and
      then Khazarian origin, and from maternal side we will share
      Israelite origin (that is why we (some of us) have Levit
      tradition).

      I will conclude this communication for today with one also
      earlier mentioned fact: we are the only representatives of
      Mongolic Race in Ashkenazi. There is no others; C,O..
      Just we-the Q's.
      It is very significant fact, as this truth separate us from any
      Middle Eastern, or European group or race.
      And also (as pointed earlier) because rulers of the Gok-Turk and
      Khazarian Empire (Jewish Converts) are represented as people of
      Mongolic Race. That exclude R1a, and R1a1, as well as other R's
      as second non-israelite haplogroup.
      It is just a leading, but I find all this far too much similar to
      be mere coincidence.

      And for Mr.Biondo's interesting writing; we are all descendants
      of people from Eastern African soil.

      Alfred

      Citiram Dave Howard <dshoward@...>:

      > Prof. Krupa is correct that there is evidence that there was a
      > Khazarian conversion and some of their DNA may have entered the
      > Ashkenazi gene
      > pool.
      >
      > This is not inconsistent with my point. We have no disagreement.
      >
      > My point is that the Khazars are not necessarily the source of our
      > Haplogroup-Q Y-Chromosome. That they may have provided some of our DNA
      > does not mean that they are also the source of our yDNA.
      >
      > If Haplogroup-Q yDNA was in the Khazarian group it will
      > be interesting to see if they had the M378 SNP mutation. It will be
      > interesting to see if we really have it as well.
      >
      > One does suspect the Khazars as a possible source in that our common
      > ancestor lived within the last 1,000 years. However, his appearance may
      > or may not coincide with the Khazarian period.
      >
      > That we may all share a common ancestor within the last 1,000 years is
      > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
      > means by "New DNA" vs. "Old DNA." The STR mutations are recent events.
      > Our SNP mutations took place thousands of years ago.
      >
      > You may find the Khazarian links Prof. Krupa provided to be interesting,
      > as I
      > did.
      >
      > At the same time make sure you read the excellent Wikipedia article
      > that discusses the Khazars including the controversy caused by the
      > book The Thirteenth Tribe as well as the current anti-semitic theory
      > that is popular among Arab states today.
      >
      > http://en.wikipedia.org/wiki/Khazars
      > <http://en.wikipedia.org/wiki/Khazars>
      >
      > Here is a brief snippet from the Wikipedia article. (I strongly
      > recommend reading the whole article at the link. The referenced
      > footnotes are in the full article.)
      >
      > The National Academy of Science study referred to below is included in
      > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
      > same yDNA pool.pdf." I encourage you to look it over.
      >
      > DNA Evidence
      >
      > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
      > features of the Khazars, who were likely of Central Asian Turkish
      > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
      > also discredited the Khazar origin theory for the vast majority of
      > Jews, including the Ashkenazi.
      >
      > A study published by the National Academy of Sciences found that "The
      > results support the hypothesis that the paternal gene pools of Jewish
      > communities from Europe, North Africa, and the Middle East descended
      > from a common Middle Eastern ancestral population, and suggest that
      > most Jewish communities have remained relatively isolated from
      > neighboring non-Jewish communities during and after the Diaspora."
      > [2]. Researchers express surprise at the remarkable genetic uniformity
      > they found among modern Jews, no matter where the diaspora has become
      > dispersed around the world. Contradicting the "mongrel" theory, DNA
      > demonstrated substantially less inter-marriage among Jews over the
      > last 3000 years than found in other populations.
      >
      > "The results accord with Jewish history and tradition and refute
      > theories like those holding that Jewish communities consist mostly of
      > converts from other faiths, or that they are descended from the
      > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
      >
      > Morever, "The analysis provides genetic witness that these communities
      > have, to a remarkable extent, retained their biological identity
      > separate from their host populations, evidence of relatively little
      > intermarriage or conversion into Judaism over the centuries." Id. And
      > another finding, paradoxical but unsurprising, is that by the
      > yardstick of the Y chromosome, the world's Jewish communities are
      > closely related to Syrians and Palestinians[44], suggesting that all
      > are descended from a common ancestral population that inhabited the
      > Middle East some four thousand years ago. Id.
      >
      > This study found that "The extremely close affinity of Jewish and
      > non-Jewish Middle Eastern populations observed ... supports the
      > hypothesis of a common Middle Eastern origin.",[45] as does the
      > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
      > population.[19] So although Khazars could possibly have been absorbed
      > into the modern Jewish population as we know it today, it is unlikely
      > that they formed a large percentage of the ancestors of modern Jews.[46]
      >
      >
      > Dave
      >
      >
      >

      ---------------------- T - C o m - - W e b m a i l ----------------------
      Ova poruka poslana je upotrebom T-Com Webmail usluge
      Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
      http://shopping.tportal.hr

       




      Vote for your city's best dining and nightlife. City's Best 2008.

    • KRUPA
      A study published in 2004 by Stephen L. Zegura states that The mutational age of Q-P36*, the marker defining the entire Q lineage, is 17,700 ± 4,820 years
      Message 2 of 10 , Jun 17, 2008
      • 0 Attachment
        A study published in 2004 by Stephen L. Zegura states that "The
        mutational age of Q-P36*, the marker defining the entire Q
        lineage, is 17,700 ± 4,820 years BP", and that its original
        source is the region of the Altay Mountains near the borders of
        Russia, Mongolia, Kazakhstan, and China (Zegura 2004, pp.
        164-175).

        +

        Haplogroup Q (Y-DNA)
        From Wikipedia, the free encyclopedia
        Jump to: navigation, search
        Haplogroup Q
        Time of origin 15,000 to 20,000 BC
        Place of origin Ural or Siberia
        Ancestor P
        Defining mutations M242
        Typical members Selkups (~70%) and Kets (~95%)

        In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA
        haplogroup.

        Haplogroup Q is a branch of haplogroup P (M45). It is believed to
        have arisen in Siberia approximately 15,000 to 20,000 years ago.

        This haplogroup contains the patrilineal ancestors of many
        Siberians, Central Asians, and indigenous peoples of the
        Americas. Haplogroup Q Y-chromosomes are also found scattered at
        a low frequency throughout Eurasia.[1] This haplogroup is diverse
        despite its low frequency among most populations outside of
        Siberia or the Americas, and at least six primary subclades have
        been sampled and identified in modern populations.
        Contents
        [hide]

        * 1 Origins
        * 2 Technical specification of mutation
        * 3 Distribution
        * 4 Discovery of ancestral Q in the Indian subcontinent
        * 5 Subgroups
        * 6 References
        * 7 External links
        * 8 See also

        [edit] Origins

        A migration from Asia into Alaska across the Bering Strait was
        done by haplogroup Q populations approximately 15,000 years ago.
        This founding population spread throughout the Americas. In the
        Americas, a member of the founding population underwent a
        mutation, producing its descendant population defined by the M3
        SNP.

        [edit] Technical specification of mutation

        The technical details of M242 are:

        Nucleotide change: C to T
        Position (base pair): 180
        Total size (base pairs): 366
        Forward 5′→ 3′: aactcttgataaaccgtgctg
        Reverse 5′→ 3′: tccaatctcaattcatgcctc

        [edit] Distribution

        In the Old World the Q lineage and its many branches is largely
        found within a huge triangle defined by Norway in the West, Iran
        in the South and Mongolia in the East. There is also a rough
        correlation between the Turkic-speaking peoples of Central
        Eurasia and Q. The frequency of Q in Norway and Mongolia is
        about 4% while in the Iranian cities of Shiraz and Esfahan, the
        frequency runs between 6% and 8%; Iranian samples of haplogroup
        Q belong almost exclusively to the M25 defined subclade. In the
        middle of this triangle, in Uzbekistan and Turkmenistan, the
        frequency of Q runs between 10% and 14%. Only two groups in the
        Old World are majority Q groups. These are the Selkups (~70%)
        and Kets (~95%). They live in western and middle Siberia and are
        small in number, being just under 5,000 and 1,500, respectively.

        [edit] Discovery of ancestral Q in the Indian subcontinent

        A Biomed study observed an ancestral state Q* and a novel
        sub-branch Q5, not reported elsewhere, in Indian subcontinent,
        though in low frequency. A novel subgroup Q4 was identified
        recently which is also restricted to Indian subcontinent. The
        most plausible explanation for these observations could be an
        ancestral migration of individuals bearing ancestral lineage Q*
        to Indian subcontinent followed by an autochthonous
        differentiation to Q4 and Q5 sublineages later on. Thus the
        subcontinent has three novel Q lineages, an ancestral Q*
        (different from the Central Asian Q*), Q4 and Q5 unique to the
        subcontinent.

        [edit] Subgroups

        The subclades of Haplogroup Q with their defining mutation(s),
        according to the 2008 ISOGG tree:

        * Q (M242)
        o Q*
        o Q1 (P36.2)
        + Q1*
        + Q1a (MEH2)
        # Q1a*
        # Q1a1 (M120, M265/N14) Found at low
        frequency among Chinese, Koreans, Dungans, and Hazara[2][3]
        # Q1a2 (M25, M143) Found at low to moderate
        frequency among some populations of Southwest Asia, Central Asia,
        and Siberia
        # Q1a3 (M346)
        * Q1a3* Found at low frequency in
        Pakistan and India
        * Q1a3a (M3) Typical of indigenous
        peoples of the Americas
        o Q1a3a*
        o Q1a3a1 (M19) Found among some
        indigenous peoples of South America, such as the Ticuna and the
        Wayuu[4]
        o Q1a3a2 (M194)
        o Q1a3a3 (M199, P106, P292)
        # Q1a4 (P48)
        # Q1a5 (P89)
        # Q1a6 (M323) Found in a significant
        minority of Yemeni Jews
        + Q1b (M378) Found at low frequency among samples
        of Hazara and Sindhis

        [edit] References

        1. ^ High-Resolution SNPs and Microsatellite Haplotypes Point
        to a Single, Recent Entry of Native American Y Chromosomes into
        the Americas, Stephen L. Zegura, Tatiana M. Karafet et al., 2003
        2. ^ Supplementary Table 2: NRY haplogroup distribution in Han
        populations, from the online supplementary material for the
        article by Bo Wen et al., "Genetic evidence supports demic
        diffusion of Han culture," Nature 431, 302-305 (16 September
        2004)
        3. ^ Table 1: Y-chromosome haplotype frequencies in 49
        Eurasian populations, listed according to geographic region,
        from the article by R. Spencer Wells et al., "The Eurasian
        Heartland: A continental perspective on Y-chromosome diversity,"
        Proceedings of the National Academy of Sciences of the United
        States of America (August 28, 2001)
        4. ^ "Y-Chromosome Evidence for Differing Ancient Demographic
        Histories in the Americas," Maria-Catira Bortolini et al.,
        American Journal of Human Genetics 73:524-539, 2003


        From above data You will see, that if we will be placed in Q1b
        subgroup, that will be ,as it seems, final proof of recent
        Asiatic origin, as it if founded on Hazara people which are of
        Mongolian and Nort Chinese origin, like Ashina Clan of Gok-Turks
        and Khazars.


        Alfred Krupa
        FTDNA Ashina Royal Dynasty DNA administrator
        http://www.familytreedna.com/public/AshinaRoyalDynasty/
        ---------------------- T - C o m - - W e b m a i l ----------------------
        Ova poruka poslana je upotrebom T-Com Webmail usluge
        Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
        http://shopping.tportal.hr
      • KRUPA
        I have included article from Wikipedia, as it quote known and new findings. About Hazara people; http://en.wikipedia.org/wiki/Hazara_people ... Ova poruka
        Message 3 of 10 , Jun 17, 2008
        • 0 Attachment
          I have included article from Wikipedia, as it quote known and new
          findings.

          About Hazara people;
          http://en.wikipedia.org/wiki/Hazara_people
          ---------------------- T - C o m - - W e b m a i l ----------------------
          Ova poruka poslana je upotrebom T-Com Webmail usluge
          Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
          http://shopping.tportal.hr
        • Rebekah Canada
          Hi, That is High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas Stephen L.
          Message 4 of 10 , Jun 17, 2008
          • 0 Attachment
            Hi,

            That is
            High-Resolution SNPs and Microsatellite Haplotypes Point to a Single,
            Recent Entry of Native American Y Chromosomes into the Americas
            Stephen L. Zegura , Tatiana M. Karafet , Lev A. Zhivotovsky , and
            Michael F. Hammer
            MBE Advance Access published on January 1, 2004, DOI 10.1093/molbev/msh009.
            Mol Biol Evol 21: 164-175.

            The free text is here.
            http://mbe.oxfordjournals.org/cgi/reprint/21/1/164

            --
            Peace and Light,
            Rebekah
          • Dave Howard
            Barry, I have searched and searched and as far as I can find there is no study that attempts to define the yDNA makeup of the Khazarians. I have found several
            Message 5 of 10 , Jun 18, 2008
            • 0 Attachment
              Barry,

              I have searched and searched and as far as I can find there is no
              study that attempts to define the yDNA makeup of the Khazarians.

              I have found several references that say this would be an excellent
              future project.

              Additionally, when Khazar crumbled as a nation it merged with the
              Maygars and many of those people are in Hungary today. Many Hungarian
              Jewish people are modern descendants of those Khazars. There are still
              place names and Khazarian words in place in those areas.

              Khazarian apparently were like the inhabitants of the Caucasus
              mountains area, i.e. stocky build, light skin, red hair and light
              colored eyes.

              Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
              have that build, skin, hair and eye color. In fact, that is what I
              look like.

              Dave


              --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@... wrote:
              >
              >
              > Hello, Comrades,
              >
              > I have been under the impression that, since we have no Khazar DNA
              in any
              > database, we must rely on matches with neighboring peoples to
              determine whether
              > there is a demonstrable relationship between us and the Khazars.
              >
              > Those neighboring peoples include Georgians, Azeris, Armenians and
              Chechens.
              >
              > Does Haplotype Q occur frequently among these people? Does anyone know?
              >
              > Thanks.
              >
              >
              > Barry Zwick in Los Angeles
              >
              >
              > In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
              > mladen.krupa@... writes:
              >
              >
              >
              >
              > I am glad to see this further explanation from Dave.
              >
              > Well, I wanted to say that if we dont share mutation for Q1b it
              > will not disapprove Khazarian origin.
              > That is because it is normal that always there was a mixture of
              > population, including mixture of Q's (some will share this
              > "additional" mutation, some will not).
              > But, also as pointed by Dave earlier and now, and me somwhere in
              > the middle, we cannot look only on SNP's as they emerged
              > thousands of years of ago. Haplotypes will show us more recent
              > connection, even if we will not share mutation for Q1b
              > classification.
              >
              > I strongly believe that our Y-chromosome is of the Gok-Turk and
              > then Khazarian origin, and from maternal side we will share
              > Israelite origin (that is why we (some of us) have Levit
              > tradition).
              >
              > I will conclude this communication for today with one also
              > earlier mentioned fact: we are the only representatives of
              > Mongolic Race in Ashkenazi. There is no others; C,O..
              > Just we-the Q's.
              > It is very significant fact, as this truth separate us from any
              > Middle Eastern, or European group or race.
              > And also (as pointed earlier) because rulers of the Gok-Turk and
              > Khazarian Empire (Jewish Converts) are represented as people of
              > Mongolic Race. That exclude R1a, and R1a1, as well as other R's
              > as second non-israelite haplogroup.
              > It is just a leading, but I find all this far too much similar to
              > be mere coincidence.
              >
              > And for Mr.Biondo's interesting writing; we are all descendants
              > of people from Eastern African soil.
              >
              > Alfred
              >
              > Citiram Dave Howard <_dshoward@..._ (mailto:dshoward@...) >:
              >
              > > Prof. Krupa is correct that there is evidence that there was a
              > > Khazarian conversion and some of their DNA may have entered the
              > > Ashkenazi gene
              > > pool.
              > >
              > > This is not inconsistent with my point. We have no disagreement.
              > >
              > > My point is that the Khazars are not necessarily the source of our
              > > Haplogroup-Q Y-Chromosome. That they may have provided some of
              our DNA
              > > does not mean that they are also the source of our yDNA.
              > >
              > > If Haplogroup-Q yDNA was in the Khazarian group it will
              > > be interesting to see if they had the M378 SNP mutation. It will be
              > > interesting to see if we really have it as well.
              > >
              > > One does suspect the Khazars as a possible source in that our common
              > > ancestor lived within the last 1,000 years. However, his
              appearance may
              > > or may not coincide with the Khazarian period.
              > >
              > > That we may all share a common ancestor within the last 1,000
              years is
              > > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
              > > means by "New DNA" vs. "Old DNA." The STR mutations are recent
              events.
              > > Our SNP mutations took place thousands of years ago.
              > >
              > > You may find the Khazarian links Prof. Krupa provided to be
              interesting,
              > > as I
              > > did.
              > >
              > > At the same time make sure you read the excellent Wikipedia article
              > > that discusses the Khazars including the controversy caused by the
              > > book The Thirteenth Tribe as well as the current anti-semitic theory
              > > that is popular among Arab states today.
              > >
              > > _http://en.wikipediahttp://en.http://_
              > (http://en.wikipedia.org/wiki/Khazars)
              > > <_http://en.wikipediahttp://en.http://_
              > (http://en.wikipedia.org/wiki/Khazars) >
              > >
              > > Here is a brief snippet from the Wikipedia article. (I strongly
              > > recommend reading the whole article at the link. The referenced
              > > footnotes are in the full article.)
              > >
              > > The National Academy of Science study referred to below is
              included in
              > > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
              > > same yDNA pool.pdf." I encourage you to look it over.
              > >
              > > DNA Evidence
              > >
              > > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
              > > features of the Khazars, who were likely of Central Asian Turkish
              > > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
              > > also discredited the Khazar origin theory for the vast majority of
              > > Jews, including the Ashkenazi.
              > >
              > > A study published by the National Academy of Sciences found that "The
              > > results support the hypothesis that the paternal gene pools of Jewish
              > > communities from Europe, North Africa, and the Middle East descended
              > > from a common Middle Eastern ancestral population, and suggest that
              > > most Jewish communities have remained relatively isolated from
              > > neighboring non-Jewish communities during and after the Diaspora."
              > > [2]. Researchers express surprise at the remarkable genetic
              uniformity
              > > they found among modern Jews, no matter where the diaspora has become
              > > dispersed around the world. Contradicting the "mongrel" theory, DNA
              > > demonstrated substantially less inter-marriage among Jews over the
              > > last 3000 years than found in other populations.
              > >
              > > "The results accord with Jewish history and tradition and refute
              > > theories like those holding that Jewish communities consist mostly of
              > > converts from other faiths, or that they are descended from the
              > > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
              > >
              > > Morever, "The analysis provides genetic witness that these
              communities
              > > have, to a remarkable extent, retained their biological identity
              > > separate from their host populations, evidence of relatively little
              > > intermarriage or conversion into Judaism over the centuries." Id. And
              > > another finding, paradoxical but unsurprising, is that by the
              > > yardstick of the Y chromosome, the world's Jewish communities are
              > > closely related to Syrians and Palestinians[ closely related to
              > > are descended from a common ancestral population that inhabited the
              > > Middle East some four thousand years ago. Id.
              > >
              > > This study found that "The extremely close affinity of Jewish and
              > > non-Jewish Middle Eastern populations observed ... supports the
              > > hypothesis of a common Middle Eastern origin.",[45] as does the
              > > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
              > > population.[ population.[<WBR>19] So although Khazars could possibly
              > > into the modern Jewish population as we know it today, it is unlikely
              > > that they formed a large percentage of the ancestors of modern
              Jews.[46]
              > >
              > >
              > > Dave
              > >
              > >
              > >
              >
              > ---------------------------------<WBR>---------<WBR>- T - C o m
              ----------
              > Ova poruka poslana je upotrebom T-Com Webmail usluge
              > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
              > _http://shopping.http://sho_ (http://shopping.tportal.hr/)
              >
              >
              >
              >
              >
              >
              >
              >
              >
              > **************Vote for your city's best dining and nightlife. City's
              Best
              > 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
              >
            • KRUPA
              Dear Dave, You have pointed several interesting things. My grandfather was very short man - 162 cm only, like his brother and sister (buried alive in Dachau),
              Message 6 of 10 , Jun 18, 2008
              • 0 Attachment
                Dear Dave,

                You have pointed several interesting things.
                My grandfather was very short man - 162 cm only, like his brother
                and sister (buried alive in Dachau), very strong builded (pre-war
                amateur champion in boxing of Poland), round head, thin lipses,
                very white skin, dark-blue eyes. Something like blue asian.
                Later generations are taller, but not too tall, still white
                skinned, strong builded.
                My sister looked in chilhood like Chinese. I have two sisters and
                brother and we all was blonde up to some age.

                I have several Hungarian Jews and converts to Christianity, in my
                exact match and near exact match lists.
                But main direction is to todays Ukraine (western Khazaria).

                Dr.Greenspan told me that it will be very difficult to find
                usable DNA in Khazarian graves, due to local climate. And that
                actually nobody is planning to undertake research in that field,
                what is odd situation for my understanding of this matter.

                Allesandro,

                Capital letters was only to underline my idea. Nothing else. As
                matter in fact I didnt write so much in English for years now!
                I cannot explain why there is no other Asiatic haplogroups in
                Ashkenazi community. As You, I can only predict or assume what
                can be reason for such state in Ashkenazi genetic pool.
                But, I am ,after all taken in consideration,pretty much convinced
                that we are from Khazaria.
                Most of us, at least.

                One hypothesis; maybe we are direct descendants of the Jewish
                Imperial family of Khazaria, not of wider ruling class? Maybe
                that is why statues shows Mongolic features? Who knows what will
                come on surface in future!
                We can only make hypothesis by now, for such statement.

                Regards,

                Alfred




                Citiram Dave Howard <dshoward@...>:

                > Barry,
                >
                > I have searched and searched and as far as I can find there is no
                > study that attempts to define the yDNA makeup of the Khazarians.
                >
                > I have found several references that say this would be an excellent
                > future project.
                >
                > Additionally, when Khazar crumbled as a nation it merged with the
                > Maygars and many of those people are in Hungary today. Many Hungarian
                > Jewish people are modern descendants of those Khazars. There are still
                > place names and Khazarian words in place in those areas.
                >
                > Khazarian apparently were like the inhabitants of the Caucasus
                > mountains area, i.e. stocky build, light skin, red hair and light
                > colored eyes.
                >
                > Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
                > have that build, skin, hair and eye color. In fact, that is what I
                > look like.
                >
                > Dave
                >
                >
                > --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@... wrote:
                >>
                >>
                >> Hello, Comrades,
                >>
                >> I have been under the impression that, since we have no Khazar DNA
                > in any
                >> database, we must rely on matches with neighboring peoples to
                > determine whether
                >> there is a demonstrable relationship between us and the Khazars.
                >>
                >> Those neighboring peoples include Georgians, Azeris, Armenians and
                > Chechens.
                >>
                >> Does Haplotype Q occur frequently among these people? Does anyone know?
                >>
                >> Thanks.
                >>
                >>
                >> Barry Zwick in Los Angeles
                >>
                >>
                >> In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
                >> mladen.krupa@... writes:
                >>
                >>
                >>
                >>
                >> I am glad to see this further explanation from Dave.
                >>
                >> Well, I wanted to say that if we dont share mutation for Q1b it
                >> will not disapprove Khazarian origin.
                >> That is because it is normal that always there was a mixture of
                >> population, including mixture of Q's (some will share this
                >> "additional" mutation, some will not).
                >> But, also as pointed by Dave earlier and now, and me somwhere in
                >> the middle, we cannot look only on SNP's as they emerged
                >> thousands of years of ago. Haplotypes will show us more recent
                >> connection, even if we will not share mutation for Q1b
                >> classification.
                >>
                >> I strongly believe that our Y-chromosome is of the Gok-Turk and
                >> then Khazarian origin, and from maternal side we will share
                >> Israelite origin (that is why we (some of us) have Levit
                >> tradition).
                >>
                >> I will conclude this communication for today with one also
                >> earlier mentioned fact: we are the only representatives of
                >> Mongolic Race in Ashkenazi. There is no others; C,O..
                >> Just we-the Q's.
                >> It is very significant fact, as this truth separate us from any
                >> Middle Eastern, or European group or race.
                >> And also (as pointed earlier) because rulers of the Gok-Turk and
                >> Khazarian Empire (Jewish Converts) are represented as people of
                >> Mongolic Race. That exclude R1a, and R1a1, as well as other R's
                >> as second non-israelite haplogroup.
                >> It is just a leading, but I find all this far too much similar to
                >> be mere coincidence.
                >>
                >> And for Mr.Biondo's interesting writing; we are all descendants
                >> of people from Eastern African soil.
                >>
                >> Alfred
                >>
                >> Citiram Dave Howard <_dshoward@..._ (mailto:dshoward@...) >:
                >>
                >> > Prof. Krupa is correct that there is evidence that there was a
                >> > Khazarian conversion and some of their DNA may have entered the
                >> > Ashkenazi gene
                >> > pool.
                >> >
                >> > This is not inconsistent with my point. We have no disagreement.
                >> >
                >> > My point is that the Khazars are not necessarily the source of our
                >> > Haplogroup-Q Y-Chromosome. That they may have provided some of
                > our DNA
                >> > does not mean that they are also the source of our yDNA.
                >> >
                >> > If Haplogroup-Q yDNA was in the Khazarian group it will
                >> > be interesting to see if they had the M378 SNP mutation. It will be
                >> > interesting to see if we really have it as well.
                >> >
                >> > One does suspect the Khazars as a possible source in that our common
                >> > ancestor lived within the last 1,000 years. However, his
                > appearance may
                >> > or may not coincide with the Khazarian period.
                >> >
                >> > That we may all share a common ancestor within the last 1,000
                > years is
                >> > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
                >> > means by "New DNA" vs. "Old DNA." The STR mutations are recent
                > events.
                >> > Our SNP mutations took place thousands of years ago.
                >> >
                >> > You may find the Khazarian links Prof. Krupa provided to be
                > interesting,
                >> > as I
                >> > did.
                >> >
                >> > At the same time make sure you read the excellent Wikipedia article
                >> > that discusses the Khazars including the controversy caused by the
                >> > book The Thirteenth Tribe as well as the current anti-semitic theory
                >> > that is popular among Arab states today.
                >> >
                >> > _http://en.wikipediahttp://en.http://_
                >> (http://en.wikipedia.org/wiki/Khazars)
                >> > <_http://en.wikipediahttp://en.http://_
                >> (http://en.wikipedia.org/wiki/Khazars) >
                >> >
                >> > Here is a brief snippet from the Wikipedia article. (I strongly
                >> > recommend reading the whole article at the link. The referenced
                >> > footnotes are in the full article.)
                >> >
                >> > The National Academy of Science study referred to below is
                > included in
                >> > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
                >> > same yDNA pool.pdf." I encourage you to look it over.
                >> >
                >> > DNA Evidence
                >> >
                >> > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
                >> > features of the Khazars, who were likely of Central Asian Turkish
                >> > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
                >> > also discredited the Khazar origin theory for the vast majority of
                >> > Jews, including the Ashkenazi.
                >> >
                >> > A study published by the National Academy of Sciences found that "The
                >> > results support the hypothesis that the paternal gene pools of Jewish
                >> > communities from Europe, North Africa, and the Middle East descended
                >> > from a common Middle Eastern ancestral population, and suggest that
                >> > most Jewish communities have remained relatively isolated from
                >> > neighboring non-Jewish communities during and after the Diaspora."
                >> > [2]. Researchers express surprise at the remarkable genetic
                > uniformity
                >> > they found among modern Jews, no matter where the diaspora has become
                >> > dispersed around the world. Contradicting the "mongrel" theory, DNA
                >> > demonstrated substantially less inter-marriage among Jews over the
                >> > last 3000 years than found in other populations.
                >> >
                >> > "The results accord with Jewish history and tradition and refute
                >> > theories like those holding that Jewish communities consist mostly of
                >> > converts from other faiths, or that they are descended from the
                >> > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
                >> >
                >> > Morever, "The analysis provides genetic witness that these
                > communities
                >> > have, to a remarkable extent, retained their biological identity
                >> > separate from their host populations, evidence of relatively little
                >> > intermarriage or conversion into Judaism over the centuries." Id. And
                >> > another finding, paradoxical but unsurprising, is that by the
                >> > yardstick of the Y chromosome, the world's Jewish communities are
                >> > closely related to Syrians and Palestinians[ closely related to
                >> > are descended from a common ancestral population that inhabited the
                >> > Middle East some four thousand years ago. Id.
                >> >
                >> > This study found that "The extremely close affinity of Jewish and
                >> > non-Jewish Middle Eastern populations observed ... supports the
                >> > hypothesis of a common Middle Eastern origin.",[45] as does the
                >> > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
                >> > population.[ population.[<WBR>19] So although Khazars could possibly
                >> > into the modern Jewish population as we know it today, it is unlikely
                >> > that they formed a large percentage of the ancestors of modern
                > Jews.[46]
                >> >
                >> >
                >> > Dave
                >> >
                >> >
                >> >
                >>
                >> ---------------------------------<WBR>---------<WBR>- T - C o m
                > ----------
                >> Ova poruka poslana je upotrebom T-Com Webmail usluge
                >> Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                >> _http://shopping.http://sho_ (http://shopping.tportal.hr/)
                >>
                >>
                >>
                >>
                >>
                >>
                >>
                >>
                >>
                >> **************Vote for your city's best dining and nightlife. City's
                > Best
                >> 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
                >>
                >
                >
                >


                ---------------------- T - C o m - - W e b m a i l ----------------------
                Ova poruka poslana je upotrebom T-Com Webmail usluge
                Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                http://shopping.tportal.hr
              • Alessandro Biondo
                Alfred, First of all, let me explain that, because we are dealing with such a difficult matter, it may happen that some misunderstanding arrive. We are more
                Message 7 of 10 , Jun 18, 2008
                • 0 Attachment
                  Alfred,

                  First of all, let me explain that, because we are dealing with such a
                  difficult matter, it may happen that some misunderstanding arrive. We
                  are more subject to misunderstandig because we need to explain, and
                  understand, such complex topics in a language that is foreign for
                  both us: I hope our american friends and you will excuse me if
                  sometime something is not enough clear in my comments or enough
                  understood by me.
                  Let me add that I think that these days we are learning something one
                  other's. The discussions are useful for this reason, even if
                  something they are a bit frustrating, for the difficult to deal with
                  complex matters, and to express these matters in a intelligible way.
                  For the question of the lack of asian haplogroup, this discussion
                  bring me to do some further thinking, and maybe there is a possible,
                  biological reason: founder's effect. But I am not a scientist, so I
                  don't know if this effect can apply to the history of the Jewish
                  people in Europe: for sure there is an isolation, but I don't know if
                  there was enough isolation, and if enough time passed to leave the
                  founder's effect free to act. So we are again chained at the same
                  point: we need more data and more, deeper, axplanations about more
                  facts. But in the future, with more data (biology, archaeology,
                  history and other fields can offer their contribute) and maybe also
                  with some little help from thoughts from the different peoples
                  commenting in this group, we have the hope to dominate a larger
                  picture of our roots.

                  Friendly.

                  Alessandro.

                  --- In Ashkenazi-Q@yahoogroups.com, KRUPA <mladen.krupa@...> wrote:
                  >
                  > Dear Dave,
                  >
                  > You have pointed several interesting things.
                  > My grandfather was very short man - 162 cm only, like his brother
                  > and sister (buried alive in Dachau), very strong builded (pre-war
                  > amateur champion in boxing of Poland), round head, thin lipses,
                  > very white skin, dark-blue eyes. Something like blue asian.
                  > Later generations are taller, but not too tall, still white
                  > skinned, strong builded.
                  > My sister looked in chilhood like Chinese. I have two sisters and
                  > brother and we all was blonde up to some age.
                  >
                  > I have several Hungarian Jews and converts to Christianity, in my
                  > exact match and near exact match lists.
                  > But main direction is to todays Ukraine (western Khazaria).
                  >
                  > Dr.Greenspan told me that it will be very difficult to find
                  > usable DNA in Khazarian graves, due to local climate. And that
                  > actually nobody is planning to undertake research in that field,
                  > what is odd situation for my understanding of this matter.
                  >
                  > Allesandro,
                  >
                  > Capital letters was only to underline my idea. Nothing else. As
                  > matter in fact I didnt write so much in English for years now!
                  > I cannot explain why there is no other Asiatic haplogroups in
                  > Ashkenazi community. As You, I can only predict or assume what
                  > can be reason for such state in Ashkenazi genetic pool.
                  > But, I am ,after all taken in consideration,pretty much convinced
                  > that we are from Khazaria.
                  > Most of us, at least.
                  >
                  > One hypothesis; maybe we are direct descendants of the Jewish
                  > Imperial family of Khazaria, not of wider ruling class? Maybe
                  > that is why statues shows Mongolic features? Who knows what will
                  > come on surface in future!
                  > We can only make hypothesis by now, for such statement.
                  >
                  > Regards,
                  >
                  > Alfred
                  >
                  >
                  >
                  >
                  > Citiram Dave Howard <dshoward@...>:
                  >
                  > > Barry,
                  > >
                  > > I have searched and searched and as far as I can find there is no
                  > > study that attempts to define the yDNA makeup of the Khazarians.
                  > >
                  > > I have found several references that say this would be an
                  excellent
                  > > future project.
                  > >
                  > > Additionally, when Khazar crumbled as a nation it merged with the
                  > > Maygars and many of those people are in Hungary today. Many
                  Hungarian
                  > > Jewish people are modern descendants of those Khazars. There are
                  still
                  > > place names and Khazarian words in place in those areas.
                  > >
                  > > Khazarian apparently were like the inhabitants of the Caucasus
                  > > mountains area, i.e. stocky build, light skin, red hair and light
                  > > colored eyes.
                  > >
                  > > Forgetting about Haplogroup Q, I know many Ashkenazi Jewish
                  people who
                  > > have that build, skin, hair and eye color. In fact, that is what I
                  > > look like.
                  > >
                  > > Dave
                  > >
                  > >
                  > > --- In Ashkenazi-Q@yahoogroups.com, Barryzwick@ wrote:
                  > >>
                  > >>
                  > >> Hello, Comrades,
                  > >>
                  > >> I have been under the impression that, since we have no Khazar
                  DNA
                  > > in any
                  > >> database, we must rely on matches with neighboring peoples to
                  > > determine whether
                  > >> there is a demonstrable relationship between us and the Khazars.
                  > >>
                  > >> Those neighboring peoples include Georgians, Azeris, Armenians
                  and
                  > > Chechens.
                  > >>
                  > >> Does Haplotype Q occur frequently among these people? Does
                  anyone know?
                  > >>
                  > >> Thanks.
                  > >>
                  > >>
                  > >> Barry Zwick in Los Angeles
                  > >>
                  > >>
                  > >> In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
                  > >> mladen.krupa@ writes:
                  > >>
                  > >>
                  > >>
                  > >>
                  > >> I am glad to see this further explanation from Dave.
                  > >>
                  > >> Well, I wanted to say that if we dont share mutation for Q1b it
                  > >> will not disapprove Khazarian origin.
                  > >> That is because it is normal that always there was a mixture of
                  > >> population, including mixture of Q's (some will share this
                  > >> "additional" mutation, some will not).
                  > >> But, also as pointed by Dave earlier and now, and me somwhere in
                  > >> the middle, we cannot look only on SNP's as they emerged
                  > >> thousands of years of ago. Haplotypes will show us more recent
                  > >> connection, even if we will not share mutation for Q1b
                  > >> classification.
                  > >>
                  > >> I strongly believe that our Y-chromosome is of the Gok-Turk and
                  > >> then Khazarian origin, and from maternal side we will share
                  > >> Israelite origin (that is why we (some of us) have Levit
                  > >> tradition).
                  > >>
                  > >> I will conclude this communication for today with one also
                  > >> earlier mentioned fact: we are the only representatives of
                  > >> Mongolic Race in Ashkenazi. There is no others; C,O..
                  > >> Just we-the Q's.
                  > >> It is very significant fact, as this truth separate us from any
                  > >> Middle Eastern, or European group or race.
                  > >> And also (as pointed earlier) because rulers of the Gok-Turk and
                  > >> Khazarian Empire (Jewish Converts) are represented as people of
                  > >> Mongolic Race. That exclude R1a, and R1a1, as well as other R's
                  > >> as second non-israelite haplogroup.
                  > >> It is just a leading, but I find all this far too much similar
                  to
                  > >> be mere coincidence.
                  > >>
                  > >> And for Mr.Biondo's interesting writing; we are all descendants
                  > >> of people from Eastern African soil.
                  > >>
                  > >> Alfred
                  > >>
                  > >> Citiram Dave Howard <_dshoward@_ (mailto:dshoward@) >:
                  > >>
                  > >> > Prof. Krupa is correct that there is evidence that there was a
                  > >> > Khazarian conversion and some of their DNA may have entered
                  the
                  > >> > Ashkenazi gene
                  > >> > pool.
                  > >> >
                  > >> > This is not inconsistent with my point. We have no
                  disagreement.
                  > >> >
                  > >> > My point is that the Khazars are not necessarily the source
                  of our
                  > >> > Haplogroup-Q Y-Chromosome. That they may have provided some of
                  > > our DNA
                  > >> > does not mean that they are also the source of our yDNA.
                  > >> >
                  > >> > If Haplogroup-Q yDNA was in the Khazarian group it will
                  > >> > be interesting to see if they had the M378 SNP mutation. It
                  will be
                  > >> > interesting to see if we really have it as well.
                  > >> >
                  > >> > One does suspect the Khazars as a possible source in that our
                  common
                  > >> > ancestor lived within the last 1,000 years. However, his
                  > > appearance may
                  > >> > or may not coincide with the Khazarian period.
                  > >> >
                  > >> > That we may all share a common ancestor within the last 1,000
                  > > years is
                  > >> > based on our STRs and not our SNPs. I believe this is what
                  Prof. Kupa
                  > >> > means by "New DNA" vs. "Old DNA." The STR mutations are recent
                  > > events.
                  > >> > Our SNP mutations took place thousands of years ago.
                  > >> >
                  > >> > You may find the Khazarian links Prof. Krupa provided to be
                  > > interesting,
                  > >> > as I
                  > >> > did.
                  > >> >
                  > >> > At the same time make sure you read the excellent Wikipedia
                  article
                  > >> > that discusses the Khazars including the controversy caused
                  by the
                  > >> > book The Thirteenth Tribe as well as the current anti-semitic
                  theory
                  > >> > that is popular among Arab states today.
                  > >> >
                  > >> > _http://en.wikipediahttp://en.http://_
                  > >> (http://en.wikipedia.org/wiki/Khazars)
                  > >> > <_http://en.wikipediahttp://en.http://_
                  > >> (http://en.wikipedia.org/wiki/Khazars) >
                  > >> >
                  > >> > Here is a brief snippet from the Wikipedia article. (I
                  strongly
                  > >> > recommend reading the whole article at the link. The
                  referenced
                  > >> > footnotes are in the full article.)
                  > >> >
                  > >> > The National Academy of Science study referred to below is
                  > > included in
                  > >> > our "Files" section entitled "Jewish and non-Jewish Middle
                  Easterners
                  > >> > same yDNA pool.pdf." I encourage you to look it over.
                  > >> >
                  > >> > DNA Evidence
                  > >> >
                  > >> > Most Jews, including Ashkenazi Jews, do not exhibit the
                  oriental
                  > >> > features of the Khazars, who were likely of Central Asian
                  Turkish
                  > >> > origin. Modern DNA studies on the Y chromosome of Jews
                  worldwide have
                  > >> > also discredited the Khazar origin theory for the vast
                  majority of
                  > >> > Jews, including the Ashkenazi.
                  > >> >
                  > >> > A study published by the National Academy of Sciences found
                  that "The
                  > >> > results support the hypothesis that the paternal gene pools
                  of Jewish
                  > >> > communities from Europe, North Africa, and the Middle East
                  descended
                  > >> > from a common Middle Eastern ancestral population, and
                  suggest that
                  > >> > most Jewish communities have remained relatively isolated from
                  > >> > neighboring non-Jewish communities during and after the
                  Diaspora."
                  > >> > [2]. Researchers express surprise at the remarkable genetic
                  > > uniformity
                  > >> > they found among modern Jews, no matter where the diaspora
                  has become
                  > >> > dispersed around the world. Contradicting the "mongrel"
                  theory, DNA
                  > >> > demonstrated substantially less inter-marriage among Jews
                  over the
                  > >> > last 3000 years than found in other populations.
                  > >> >
                  > >> > "The results accord with Jewish history and tradition and
                  refute
                  > >> > theories like those holding that Jewish communities consist
                  mostly of
                  > >> > converts from other faiths, or that they are descended from
                  the
                  > >> > Khazars, a medieval Turkish tribe that adopted Judaism." [3]
                  [43]
                  > >> >
                  > >> > Morever, "The analysis provides genetic witness that these
                  > > communities
                  > >> > have, to a remarkable extent, retained their biological
                  identity
                  > >> > separate from their host populations, evidence of relatively
                  little
                  > >> > intermarriage or conversion into Judaism over the centuries."
                  Id. And
                  > >> > another finding, paradoxical but unsurprising, is that by the
                  > >> > yardstick of the Y chromosome, the world's Jewish communities
                  are
                  > >> > closely related to Syrians and Palestinians[ closely related
                  to
                  > >> > are descended from a common ancestral population that
                  inhabited the
                  > >> > Middle East some four thousand years ago. Id.
                  > >> >
                  > >> > This study found that "The extremely close affinity of Jewish
                  and
                  > >> > non-Jewish Middle Eastern populations observed ... supports
                  the
                  > >> > hypothesis of a common Middle Eastern origin.",[45] as does
                  the
                  > >> > mitochondrial DNA (mtDNA) of at least 40% of the current
                  Ashkenazi
                  > >> > population.[ population.[<WBR>19] So although Khazars could
                  possibly
                  > >> > into the modern Jewish population as we know it today, it is
                  unlikely
                  > >> > that they formed a large percentage of the ancestors of modern
                  > > Jews.[46]
                  > >> >
                  > >> >
                  > >> > Dave
                  > >> >
                  > >> >
                  > >> >
                  > >>
                  > >> ---------------------------------<WBR>---------<WBR>- T - C o m
                  > > ----------
                  > >> Ova poruka poslana je upotrebom T-Com Webmail usluge
                  > >> Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                  > >> _http://shopping.http://sho_ (http://shopping.tportal.hr/)
                  > >>
                  > >>
                  > >>
                  > >>
                  > >>
                  > >>
                  > >>
                  > >>
                  > >>
                  > >> **************Vote for your city's best dining and nightlife.
                  City's
                  > > Best
                  > >> 2008. (http://citysbest.aol.com?ncid=aolacg00050000000102)
                  > >>
                  > >
                  > >
                  > >
                  >
                  >
                  > ---------------------- T - C o m - - W e b m a i l -----------------
                  -----
                  > Ova poruka poslana je upotrebom T-Com Webmail usluge
                  > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                  > http://shopping.tportal.hr
                  >
                • Barryzwick@aol.com
                  Thanks so much for all your research, Dave, not only on this but on other DNA questions. There is a conflict between Alfred s insistence that Khazars were
                  Message 8 of 10 , Jun 18, 2008
                  • 0 Attachment
                    Thanks so much for all your research, Dave, not only on this but on other DNA questions.
                     
                    There is a conflict between Alfred's insistence that Khazars were Mongolian and your own personal description. I suspect that red hair and light-colored eyes are rare among Mongolians. You can't both be right.
                     
                    As to whether the Khazars "merged" with the Magyars, I have never read that it was anything quite that concrete. The Khazars indeed left some traces in Hungary. Whether this was a mass movement is quite another matter. Since so many of the Khazars were Muslim, how could it come to be that Judaism survived among the Khazarian transplants, but Islam did not?
                     
                    Since the Khazars did not chronicle what became of themselves, we can only guess. They diverged strongly from the people among whom they lived, who kept track of every ruler, every harvest and every battle. The Khazars had no written language. This alone would have made their survival as Jews close to miraculous. They could have left records in Hebrew, true, but we have no evidence that they did.
                     
                    I'm afraid I remain a skeptic.
                     
                    I'm following this discussion with a great deal of interest. We are lucky that so many well-informed people share our genetic heritage.
                     
                    Barry
                     
                    Barry Zwick in Los Angeles
                     
                     
                    In a message dated 6/18/2008 11:29:29 A.M. Pacific Daylight Time, dshoward@... writes:

                    Barry,

                    I have searched and searched and as far as I can find there is no
                    study that attempts to define the yDNA makeup of the Khazarians.

                    I have found several references that say this would be an excellent
                    future project.

                    Additionally, when Khazar crumbled as a nation it merged with the
                    Maygars and many of those people are in Hungary today. Many Hungarian
                    Jewish people are modern descendants of those Khazars. There are still
                    place names and Khazarian words in place in those areas.

                    Khazarian apparently were like the inhabitants of the Caucasus
                    mountains area, i.e. stocky build, light skin, red hair and light
                    colored eyes.

                    Forgetting about Haplogroup Q, I know many Ashkenazi Jewish people who
                    have that build, skin, hair and eye color. In fact, that is what I
                    look like.

                    Dave

                    --- In Ashkenazi-Q@ yahoogroups. com, Barryzwick@. .. wrote:
                    >
                    >
                    > Hello, Comrades,
                    >
                    > I have been under the impression that, since we have no Khazar DNA
                    in any
                    > database, we must rely on matches with neighboring peoples to
                    determine whether
                    > there is a demonstrable relationship between us and the Khazars.
                    >
                    > Those neighboring peoples include Georgians, Azeris, Armenians and
                    Chechens.
                    >
                    > Does Haplotype Q occur frequently among these people? Does anyone know?
                    >
                    > Thanks.
                    >
                    >
                    > Barry Zwick in Los Angeles
                    >
                    >
                    > In a message dated 6/15/2008 1:23:59 P.M. Pacific Daylight Time,
                    > mladen.krupa@ ... writes:
                    >
                    >
                    >
                    >
                    > I am glad to see this further explanation from Dave.
                    >
                    > Well, I wanted to say that if we dont share mutation for Q1b it
                    > will not disapprove Khazarian origin.
                    > That is because it is normal that always there was a mixture of
                    > population, including mixture of Q's (some will share this
                    > "additional" mutation, some will not).
                    > But, also as pointed by Dave earlier and now, and me somwhere in
                    > the middle, we cannot look only on SNP's as they emerged
                    > thousands of years of ago. Haplotypes will show us more recent
                    > connection, even if we will not share mutation for Q1b
                    > classification.
                    >
                    > I strongly believe that our Y-chromosome is of the Gok-Turk and
                    > then Khazarian origin, and from maternal side we will share
                    > Israelite origin (that is why we (some of us) have Levit
                    > tradition).
                    >
                    > I will conclude this communication for today with one also
                    > earlier mentioned fact: we are the only representatives of
                    > Mongolic Race in Ashkenazi. There is no others; C,O..
                    > Just we-the Q's.
                    > It is very significant fact, as this truth separate us from any
                    > Middle Eastern, or European group or race.
                    > And also (as pointed earlier) because rulers of the Gok-Turk and
                    > Khazarian Empire (Jewish Converts) are represented as people of
                    > Mongolic Race. That exclude R1a, and R1a1, as well as other R's
                    > as second non-israelite haplogroup.
                    > It is just a leading, but I find all this far too much similar to
                    > be mere coincidence.
                    >
                    > And for Mr.Biondo's interesting writing; we are all descendants
                    > of people from Eastern African soil.
                    >
                    > Alfred
                    >
                    > Citiram Dave Howard <_dshoward@. .._ (mailto:dshoward@ ...) >:
                    >
                    > > Prof. Krupa is correct that there is evidence that there was a
                    > > Khazarian conversion and some of their DNA may have entered the
                    > > Ashkenazi gene
                    > > pool.
                    > >
                    > > This is not inconsistent with my point. We have no disagreement.
                    > >
                    > > My point is that the Khazars are not necessarily the source of our
                    > > Haplogroup-Q Y-Chromosome. That they may have provided some of
                    our DNA
                    > > does not mean that they are also the source of our yDNA.
                    > >
                    > > If Haplogroup-Q yDNA was in the Khazarian group it will
                    > > be interesting to see if they had the M378 SNP mutation. It will be
                    > > interesting to see if we really have it as well.
                    > >
                    > > One does suspect the Khazars as a possible source in that our common
                    > > ancestor lived within the last 1,000 years. However, his
                    appearance may
                    > > or may not coincide with the Khazarian period.
                    > >
                    > > That we may all share a common ancestor within the last 1,000
                    years is
                    > > based on our STRs and not our SNPs. I believe this is what Prof. Kupa
                    > > means by "New DNA" vs. "Old DNA." The STR mutations are recent
                    events.
                    > > Our SNP mutations took place thousands of years ago.
                    > >
                    > > You may find the Khazarian links Prof. Krupa provided to be
                    interesting,
                    > > as I
                    > > did.
                    > >
                    > > At the same time make sure you read the excellent Wikipedia article
                    > > that discusses the Khazars including the controversy caused by the
                    > > book The Thirteenth Tribe as well as the current anti-semitic theory
                    > > that is popular among Arab states today.
                    > >
                    > > _http://en.wikipedia http://en. http://_
                    > (http://en.wikipedia .org/wiki/ Khazars)
                    > > <_http://en.wikipedia http://en. http://_
                    > (http://en.wikipedia .org/wiki/ Khazars) >
                    > >
                    > > Here is a brief snippet from the Wikipedia article. (I strongly
                    > > recommend reading the whole article at the link. The referenced
                    > > footnotes are in the full article.)
                    > >
                    > > The National Academy of Science study referred to below is
                    included in
                    > > our "Files" section entitled "Jewish and non-Jewish Middle Easterners
                    > > same yDNA pool.pdf." I encourage you to look it over.
                    > >
                    > > DNA Evidence
                    > >
                    > > Most Jews, including Ashkenazi Jews, do not exhibit the oriental
                    > > features of the Khazars, who were likely of Central Asian Turkish
                    > > origin. Modern DNA studies on the Y chromosome of Jews worldwide have
                    > > also discredited the Khazar origin theory for the vast majority of
                    > > Jews, including the Ashkenazi.
                    > >
                    > > A study published by the National Academy of Sciences found that "The
                    > > results support the hypothesis that the paternal gene pools of Jewish
                    > > communities from Europe, North Africa, and the Middle East descended
                    > > from a common Middle Eastern ancestral population, and suggest that
                    > > most Jewish communities have remained relatively isolated from
                    > > neighboring non-Jewish communities during and after the Diaspora."
                    > > [2]. Researchers express surprise at the remarkable genetic
                    uniformity
                    > > they found among modern Jews, no matter where the diaspora has become
                    > > dispersed around the world. Contradicting the "mongrel" theory, DNA
                    > > demonstrated substantially less inter-marriage among Jews over the
                    > > last 3000 years than found in other populations.
                    > >
                    > > "The results accord with Jewish history and tradition and refute
                    > > theories like those holding that Jewish communities consist mostly of
                    > > converts from other faiths, or that they are descended from the
                    > > Khazars, a medieval Turkish tribe that adopted Judaism." [3] [43]
                    > >
                    > > Morever, "The analysis provides genetic witness that these
                    communities
                    > > have, to a remarkable extent, retained their biological identity
                    > > separate from their host populations, evidence of relatively little
                    > > intermarriage or conversion into Judaism over the centuries." Id. And
                    > > another finding, paradoxical but unsurprising, is that by the
                    > > yardstick of the Y chromosome, the world's Jewish communities are
                    > > closely related to Syrians and Palestinians[ closely related to
                    > > are descended from a common ancestral population that inhabited the
                    > > Middle East some four thousand years ago. Id.
                    > >
                    > > This study found that "The extremely close affinity of Jewish and
                    > > non-Jewish Middle Eastern populations observed ... supports the
                    > > hypothesis of a common Middle Eastern origin.",[45] as does the
                    > > mitochondrial DNA (mtDNA) of at least 40% of the current Ashkenazi
                    > > population.[ population.[ <WBR>19] So although Khazars could possibly
                    > > into the modern Jewish population as we know it today, it is unlikely
                    > > that they formed a large percentage of the ancestors of modern
                    Jews.[46]
                    > >
                    > >
                    > > Dave
                    > >
                    > >
                    > >
                    >
                    > ------------ --------- --------- ---<WBR>- --------< WBR>- T - C o m
                    ----------
                    > Ova poruka poslana je upotrebom T-Com Webmail usluge
                    > Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                    > _http://shopping. http://sho_ (http://shopping. tportal.hr/)
                    >
                    >
                    >
                    >
                    >
                    >
                    >
                    >
                    >
                    > ************ **Vote for your city's best dining and nightlife. City's
                    Best
                    > 2008. (http://citysbest. aol.com?ncid= aolacg0005000000 0102)
                    >

                     




                    Gas prices getting you down? Search AOL Autos for fuel-efficient used cars.
                  • KRUPA
                    Barry, I am red, particulary in beard. Khazars used Turkic Runes, and later Hebrew. Alfred ... Ova poruka poslana je upotrebom T-Com Webmail usluge Uzivajte u
                    Message 9 of 10 , Jun 18, 2008
                    • 0 Attachment
                      Barry,

                      I am red, particulary in beard.

                      Khazars used Turkic Runes, and later Hebrew.


                      Alfred




                      ---------------------- T - C o m - - W e b m a i l ----------------------
                      Ova poruka poslana je upotrebom T-Com Webmail usluge
                      Uzivajte u shoppingu ne napustajuci udobnost svoga doma!
                      http://shopping.tportal.hr
                    Your message has been successfully submitted and would be delivered to recipients shortly.